ID: 968306501

View in Genome Browser
Species Human (GRCh38)
Location 3:197654575-197654597
Sequence GGGGGAGGCCGCGGGGCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968306490_968306501 0 Left 968306490 3:197654552-197654574 CCGCTGGGGACCCGGCAGGTGAC No data
Right 968306501 3:197654575-197654597 GGGGGAGGCCGCGGGGCAACCGG No data
968306496_968306501 -10 Left 968306496 3:197654562-197654584 CCCGGCAGGTGACGGGGGAGGCC No data
Right 968306501 3:197654575-197654597 GGGGGAGGCCGCGGGGCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968306501 Original CRISPR GGGGGAGGCCGCGGGGCAAC CGG Intergenic
No off target data available for this crispr