ID: 968308491

View in Genome Browser
Species Human (GRCh38)
Location 3:197665221-197665243
Sequence AGGAGCCGCTGTGCGCGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968308491_968308503 17 Left 968308491 3:197665221-197665243 CCTGAACGCGCACAGCGGCTCCT No data
Right 968308503 3:197665261-197665283 CCGCGCCCGCGTCCTCGGGCCGG No data
968308491_968308498 12 Left 968308491 3:197665221-197665243 CCTGAACGCGCACAGCGGCTCCT No data
Right 968308498 3:197665256-197665278 CCGCCCCGCGCCCGCGTCCTCGG No data
968308491_968308507 30 Left 968308491 3:197665221-197665243 CCTGAACGCGCACAGCGGCTCCT No data
Right 968308507 3:197665274-197665296 CTCGGGCCGGCAGCGCCCCCTGG No data
968308491_968308499 13 Left 968308491 3:197665221-197665243 CCTGAACGCGCACAGCGGCTCCT No data
Right 968308499 3:197665257-197665279 CGCCCCGCGCCCGCGTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968308491 Original CRISPR AGGAGCCGCTGTGCGCGTTC AGG (reversed) Intergenic
No off target data available for this crispr