ID: 968312255

View in Genome Browser
Species Human (GRCh38)
Location 3:197693871-197693893
Sequence CCTTATATTGTGACACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968312255_968312259 8 Left 968312255 3:197693871-197693893 CCTTCCAGTGTCACAATATAAGG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 968312259 3:197693902-197693924 ATGACCTCAACAGAGAGAAATGG 0: 1
1: 0
2: 2
3: 30
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968312255 Original CRISPR CCTTATATTGTGACACTGGA AGG (reversed) Intronic
900931205 1:5739023-5739045 CCTCACAGTGTGACTCTGGATGG - Intergenic
903449301 1:23442132-23442154 CCTTGTTCTGTGACACTGGAAGG + Intronic
904556365 1:31367475-31367497 CAGTCCATTGTGACACTGGATGG - Exonic
904920249 1:34002371-34002393 CCTTGTCTTGTGACAATGGCAGG + Intronic
905735172 1:40320015-40320037 TCTTAAAATGTGACACTGGCTGG - Intergenic
905829256 1:41051522-41051544 CCATATCTTGTCCCACTGGAAGG - Intronic
906796945 1:48704669-48704691 CCACATCTTGTGACACGGGAAGG + Intronic
913340453 1:117753096-117753118 CCGTATATTTCCACACTGGAGGG + Intergenic
915506962 1:156363742-156363764 CCACATCTTGTCACACTGGAAGG + Intronic
916897023 1:169175230-169175252 CCATATCTTGTCCCACTGGAAGG + Intronic
917188555 1:172388793-172388815 CCTTACCTTGGGACACTGGGCGG - Exonic
918134174 1:181656288-181656310 CCATATCTTGTCCCACTGGAAGG - Intronic
921380830 1:214523109-214523131 TCCTATATTGTGACAATGTAAGG - Intronic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922240495 1:223752514-223752536 CCATATATTGTCACATTTGATGG + Intronic
1064171512 10:13037858-13037880 CCTTAGTTGGTGAAACTGGATGG + Intronic
1065666710 10:28071026-28071048 CCTCACCTGGTGACACTGGAAGG + Intronic
1067982642 10:51104379-51104401 CTGTATATTGTGATACTGAAAGG + Intronic
1069211215 10:65761886-65761908 CCTCATCTTGTCCCACTGGAAGG + Intergenic
1070892816 10:79954687-79954709 CCTTCTATTGGGGCCCTGGATGG + Intronic
1072310266 10:94147585-94147607 CACTATATTGTGACAGCGGAGGG + Intronic
1072998121 10:100264729-100264751 CCATATCTTGTCCCACTGGAAGG - Intronic
1075498111 10:122945530-122945552 CCATATCTTGTCCCACTGGAAGG - Intronic
1075740958 10:124696283-124696305 CCTTTTATTGTGACTTTAGAAGG - Intronic
1076703740 10:132289812-132289834 CCTAATACTGTCACTCTGGAGGG + Intronic
1077751985 11:4981926-4981948 CCATATCTTGTCCCACTGGAAGG + Intronic
1082088138 11:48066932-48066954 CATTTAATTGTGACCCTGGAAGG - Intronic
1083072909 11:60005162-60005184 CCACATATTGTCCCACTGGAAGG - Intergenic
1083715464 11:64572716-64572738 CCTTATTGTGAGCCACTGGAGGG - Exonic
1085142496 11:74159428-74159450 CCATATCTTGTTCCACTGGAAGG - Intronic
1087921629 11:103873338-103873360 CCACATTTTGTCACACTGGAAGG - Intergenic
1088868477 11:113871524-113871546 ACTTTGATTGTGACTCTGGAGGG - Intronic
1089115474 11:116091613-116091635 CTTTATCAGGTGACACTGGAAGG - Intergenic
1089132077 11:116220099-116220121 ACTTATATTGTGGCCCTTGAAGG - Intergenic
1091628806 12:2142636-2142658 CCACATCTTGTGCCACTGGAAGG - Intronic
1091812749 12:3413512-3413534 CCTCATCTTGTCCCACTGGAAGG + Intronic
1093817101 12:23562160-23562182 TCTTATGTTGTAACACTGCAAGG + Intronic
1094194206 12:27729200-27729222 CCTTGTATTTTGACACAAGATGG + Intronic
1097630884 12:62060700-62060722 CCATATCTTGTCCCACTGGAAGG - Intronic
1099832942 12:87868593-87868615 CCTTAGATTCTGCCACTGGGAGG - Intergenic
1100061620 12:90584998-90585020 CCATATTTTTTAACACTGGAAGG + Intergenic
1102388552 12:112531364-112531386 CCTAATACTATGCCACTGGAGGG - Intergenic
1107077965 13:36344327-36344349 CCTAATAATGTGTCAATGGAGGG + Intronic
1107262160 13:38506033-38506055 CCTTATATTGTAATACTTAAAGG + Intergenic
1108380599 13:49850538-49850560 CCTTATGTGGTATCACTGGAAGG - Intergenic
1108979111 13:56488019-56488041 CCTTTTATTGAGCCACTGAAGGG + Intergenic
1110420298 13:75300045-75300067 GCTTTTCTTATGACACTGGAGGG + Intronic
1111391032 13:87595041-87595063 CCGTATCTTGTCTCACTGGAAGG - Intergenic
1114913323 14:27228903-27228925 CCTTATTTTTTAACAATGGAGGG - Intergenic
1117123073 14:52590102-52590124 CCACATCTTGTGCCACTGGAAGG - Intronic
1121134466 14:91483040-91483062 CCTAATTTTATGCCACTGGAGGG + Intronic
1124851901 15:33347788-33347810 CCTTACTTTCTGACACTAGAAGG + Intronic
1125444159 15:39735917-39735939 CCATATCTTGTCCCACTGGAAGG + Intronic
1125990680 15:44104076-44104098 CCATATCTTGTCCCACTGGAAGG - Intronic
1128703958 15:69825048-69825070 ACAGATATTGTGAAACTGGAGGG + Intergenic
1129112860 15:73348009-73348031 ACTTATAGGCTGACACTGGAGGG + Intronic
1131771095 15:95737925-95737947 CCTTATGTTGTGGCACCTGAGGG - Intergenic
1134789436 16:16975643-16975665 CCATATCTTGTCCCACTGGAAGG - Intergenic
1138663330 16:58540131-58540153 CCTTGTACTGTGCCACTTGATGG - Intronic
1140971569 16:80018518-80018540 GTTTATATTGTGACATTGCATGG - Intergenic
1143582531 17:7835296-7835318 GCTTATGTTGTGACACTGGTGGG + Intergenic
1144576160 17:16431015-16431037 TTTTATTTTGTGACCCTGGAAGG + Intronic
1146078039 17:29750977-29750999 CCATATCTTGCCACACTGGAAGG + Intronic
1155785121 18:29886693-29886715 TCTTCTTTTGTGACACTGTAAGG - Intergenic
1155846565 18:30715446-30715468 CCATATCTTGTCTCACTGGAAGG + Intergenic
1156249762 18:35341611-35341633 CCATATCTTGTCCCACTGGAAGG - Intronic
1157717388 18:49897319-49897341 CCATATCTTGTTCCACTGGAAGG - Intronic
1159206369 18:65257986-65258008 CCATATTTTGTCCCACTGGAAGG - Intergenic
1165994861 19:39836812-39836834 ACTCATCTTGGGACACTGGAGGG - Intronic
929748077 2:44680102-44680124 CATGATACTGTGACACTGGCTGG + Intronic
930724245 2:54667098-54667120 CCTATTAGTGTGACACTGGGAGG - Intronic
935866292 2:107391273-107391295 CCATATCTTGTCCCACTGGAAGG - Intergenic
937680477 2:124639397-124639419 GCTTATATTCTGATTCTGGAGGG - Intronic
937787830 2:125923118-125923140 TCGTACATTGTGACAATGGACGG + Intergenic
939929830 2:148219252-148219274 CCATATCTTGTCTCACTGGAAGG + Intronic
940842134 2:158596167-158596189 CCTTTTATTGTGCCATTGGTGGG - Intronic
941891751 2:170589442-170589464 CCATATCTTGTCCCACTGGAAGG - Intronic
942212413 2:173684769-173684791 GCTCATAATGTGAGACTGGAAGG - Intergenic
943265177 2:185721452-185721474 CCATATCTTGTCCCACTGGAAGG - Intergenic
944044972 2:195400384-195400406 CCTTAAACTGTCATACTGGATGG - Intergenic
944987466 2:205193824-205193846 CCAAATCCTGTGACACTGGAGGG + Intronic
946724074 2:222644122-222644144 ACTTATATTGTGGCAGTGGGAGG - Intronic
1168861629 20:1049819-1049841 CCTTCTAAGGTGAGACTGGAAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1174778362 20:53366052-53366074 CTTTTTCTTCTGACACTGGAAGG - Intronic
1179076090 21:38123148-38123170 TCTTCTATTCTGACCCTGGATGG + Intronic
1182168276 22:28199001-28199023 CATTATGTTGTGACACTGACAGG - Intronic
1182869219 22:33631556-33631578 CCTTACCTTGTCCCACTGGAAGG + Intronic
1183182997 22:36273902-36273924 CCTTGTATTCTGACACTTTAGGG + Intergenic
1184075227 22:42172812-42172834 CCTTATGTTGGCACACTGCAGGG + Intronic
956788989 3:72666113-72666135 CCTTCTATTGTGTCAATAGAAGG - Intergenic
956869020 3:73398232-73398254 CCTGATAATGTTACACTGCAGGG + Intronic
957552505 3:81725390-81725412 CCATATCTTGTCCCACTGGAAGG + Intronic
958168040 3:89902459-89902481 CCATATGTTGTCCCACTGGAAGG + Intergenic
958603058 3:96323854-96323876 CCATGTATTGTCACAATGGATGG - Intergenic
958761543 3:98315024-98315046 CCACATCTTGTGCCACTGGAAGG - Intergenic
960560975 3:119083979-119084001 CCATATTTTGTCTCACTGGAAGG - Intronic
962670673 3:137704804-137704826 CCATATCTTGTCCCACTGGAAGG + Intergenic
964093486 3:152903169-152903191 CCATATCTTGTGCCACAGGAAGG - Intergenic
965258456 3:166446890-166446912 CCGTATCTTGTGTCACTGGAAGG + Intergenic
967696363 3:192536425-192536447 CCATGTATTGTGACTTTGGAGGG - Intronic
968312255 3:197693871-197693893 CCTTATATTGTGACACTGGAAGG - Intronic
969195424 4:5559592-5559614 CCTTATTTTCTGGCACTAGAAGG - Intronic
971364041 4:25962176-25962198 CCATATCTTGTTCCACTGGAAGG + Intergenic
974124858 4:57683618-57683640 CATTAAATTGTGACACAGGCTGG - Intergenic
974667277 4:64980269-64980291 CCATATCTTGTACCACTGGAAGG - Intergenic
976394561 4:84542283-84542305 CCATATCTTGTCCCACTGGAAGG + Intergenic
976423752 4:84875811-84875833 CCATATCTTGTCTCACTGGAAGG + Intronic
978067665 4:104425431-104425453 CCTTGTATAGTCACTCTGGAAGG + Intergenic
978854375 4:113376903-113376925 CCACATATTGTCCCACTGGAAGG + Intronic
978972009 4:114820232-114820254 TCTTATATTTTTACACTGGTGGG - Intergenic
981125475 4:141101410-141101432 CCATATATTGTCCCATTGGAAGG + Intronic
981246381 4:142544630-142544652 CATCATATTGTGACTCTGGAGGG + Intronic
982752704 4:159181530-159181552 GCTTATATTCTGACAATGTAAGG - Intronic
985400522 4:189588821-189588843 CCACATATTGTCCCACTGGAAGG - Intergenic
986223286 5:5789553-5789575 TCTAATATAGTCACACTGGAGGG + Intergenic
989711050 5:44397873-44397895 CCCTATCTTGTCAGACTGGAGGG - Intergenic
989761047 5:45017111-45017133 CCATATTTTGTACCACTGGAAGG - Intergenic
990108875 5:52298101-52298123 CCATATGTTGTCCCACTGGAAGG + Intergenic
990203753 5:53407158-53407180 CCACATTTTGTGCCACTGGAAGG - Intergenic
992712626 5:79475297-79475319 TCTTATACTGAGTCACTGGATGG + Intronic
993089508 5:83407781-83407803 CCATATCTTGTCCCACTGGAAGG + Intergenic
996350237 5:122532312-122532334 CCCTAGGTTGTGACTCTGGATGG - Intergenic
998281630 5:140814315-140814337 CCATATCTTGTCCCACTGGAAGG + Intronic
1001078491 5:168648292-168648314 CCATATCTTGTCCCACTGGAAGG - Intergenic
1001395218 5:171414385-171414407 TCATATATTGTCTCACTGGAAGG + Intergenic
1002473179 5:179449551-179449573 TCTTATCTTGTGAGACTGGGAGG + Intergenic
1002481044 5:179501102-179501124 TCTTATCTTGTGAGACTGGAAGG - Intergenic
1012077084 6:94703046-94703068 CCATATTTTGTCCCACTGGAAGG + Intergenic
1012146476 6:95690119-95690141 CCGTATTTTGTTTCACTGGAAGG - Intergenic
1013755126 6:113452571-113452593 CCATATCTTGTCCCACTGGAAGG + Intergenic
1014347021 6:120283997-120284019 CATTATCTTGTCCCACTGGAAGG + Intergenic
1014396971 6:120935930-120935952 CTTTATATTGTCCCTCTGGATGG - Intergenic
1014579419 6:123118054-123118076 CCACATCTTGTGCCACTGGAAGG - Intergenic
1015840199 6:137468472-137468494 CCATATATTGTCCCACTGGAAGG - Intergenic
1015914065 6:138197244-138197266 CCATATCTTGTCCCACTGGAAGG + Intronic
1017673047 6:156785407-156785429 CCTTATCAGGTGACTCTGGAAGG + Intronic
1018256135 6:161921248-161921270 CCATATATTGTCCCACTGGAAGG + Intronic
1019215081 6:170438324-170438346 CCTGAGATAGTGACACTGGAAGG + Intergenic
1019999123 7:4744897-4744919 GCTTTTATTGTAACAATGGAAGG - Intronic
1020946455 7:14614585-14614607 ACTTATATTGTTAAACAGGAAGG - Intronic
1024193040 7:47032002-47032024 CCTGATATTGTACCACTGGTGGG - Intergenic
1024784852 7:52895558-52895580 CCATATCTTGTCCCACTGGAAGG - Intergenic
1024949701 7:54847158-54847180 CCATATCTTGTCCCACTGGAAGG + Intergenic
1027788089 7:82605363-82605385 CCCTTTATTGTGACACTAAATGG - Intergenic
1031649183 7:124264949-124264971 CATTACATTCTGACACTGCAAGG - Intergenic
1031716244 7:125112255-125112277 CCTTATCTTGTCTCACTGGAAGG + Intergenic
1035870686 8:3133496-3133518 CCTGTTACTGTTACACTGGAAGG + Intronic
1036273452 8:7329568-7329590 GCTTACATTGTGACTATGGAAGG - Intergenic
1036347897 8:7980784-7980806 GCTTACATTGTGACTATGGAAGG + Intergenic
1037698239 8:21246954-21246976 CCTTCTATCTTGCCACTGGATGG - Intergenic
1038037300 8:23697125-23697147 CCTTAGACTCTGACTCTGGATGG + Intergenic
1041664774 8:60432550-60432572 CCTTGTATTGTTTCACAGGAAGG + Intergenic
1045358695 8:101412432-101412454 CCTGATATGGGGAGACTGGAAGG - Intergenic
1047142582 8:122158034-122158056 CCACATATTGTCCCACTGGAAGG - Intergenic
1050849771 9:10268977-10268999 TTTTTGATTGTGACACTGGAGGG - Intronic
1055287829 9:74748489-74748511 CCTCATCTTGTCCCACTGGAAGG - Intronic
1055587616 9:77771843-77771865 CCTTAAATTGTGTCACAGAAAGG + Intronic
1056748603 9:89327664-89327686 CCACATATTGTCCCACTGGAAGG + Intronic
1057116354 9:92526133-92526155 CCATATCTTGTCCCACTGGAAGG - Intronic
1057762131 9:97884798-97884820 CCATATTTTGTTCCACTGGAAGG + Intergenic
1058033838 9:100229283-100229305 TCTAATATTGTGACAATGAATGG + Intronic
1058224870 9:102347512-102347534 CCTTATAGTGTGTAACTGAATGG - Intergenic
1059951523 9:119467615-119467637 CCATATCTTGTCCCACTGGAAGG - Intergenic
1061667019 9:132166494-132166516 TCTCAAATTGTGACAGTGGATGG - Exonic
1185792346 X:2936962-2936984 CCTTATGTTGTATCAGTGGAGGG + Intronic
1186099379 X:6139349-6139371 TGTTACATTGTGACATTGGAGGG - Intronic
1188084794 X:25890650-25890672 CCACATATTGTCCCACTGGAAGG + Intergenic
1189621202 X:42840130-42840152 CCATATCTTGTTCCACTGGAAGG - Intergenic
1195143744 X:101991557-101991579 CCACATCTTGTGCCACTGGAAGG + Intergenic
1195449888 X:104999230-104999252 CCTTCTATTGTTACAATGGATGG - Intronic
1196265375 X:113638163-113638185 CCACATCTTGTCACACTGGAAGG + Intergenic
1197047258 X:122012454-122012476 CCTCATCTTGTCCCACTGGAAGG - Intergenic
1199202163 X:145104684-145104706 CCTTATATTATCACATTGGAAGG - Intergenic
1201280897 Y:12341054-12341076 CCTTATATTGTATCAGTGGAGGG - Intergenic