ID: 968315102

View in Genome Browser
Species Human (GRCh38)
Location 3:197717348-197717370
Sequence CCGGGTTCACAGCATTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1053
Summary {0: 1, 1: 21, 2: 161, 3: 249, 4: 621}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968315102_968315110 27 Left 968315102 3:197717348-197717370 CCAGGAGAATGCTGTGAACCCGG 0: 1
1: 21
2: 161
3: 249
4: 621
Right 968315110 3:197717398-197717420 CGCACCACCGCACTCCAGCCTGG 0: 405
1: 22432
2: 109531
3: 193248
4: 219695
968315102_968315111 28 Left 968315102 3:197717348-197717370 CCAGGAGAATGCTGTGAACCCGG 0: 1
1: 21
2: 161
3: 249
4: 621
Right 968315111 3:197717399-197717421 GCACCACCGCACTCCAGCCTGGG 0: 949
1: 48849
2: 135525
3: 204420
4: 192516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968315102 Original CRISPR CCGGGTTCACAGCATTCTCC TGG (reversed) Intronic
900240165 1:1612955-1612977 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
900270371 1:1783931-1783953 CTGGGTTCACGCCATTCTCCTGG - Intergenic
900317465 1:2065583-2065605 CCGGGTTCAGGCTATTCTCCTGG - Intronic
900676340 1:3888898-3888920 CCGGGTTCAAGCGATTCTCCAGG - Intergenic
900692473 1:3988882-3988904 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
900743501 1:4344558-4344580 CGGGTTTCCCAGTATTCTCCTGG - Intergenic
901469168 1:9443723-9443745 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
901480149 1:9519554-9519576 CTGGGTTCATGCCATTCTCCTGG - Intergenic
901683870 1:10932725-10932747 CCGGGTTCAGGCCATTCTCCAGG + Intergenic
902308689 1:15563754-15563776 CCGGGTTCACGCCATTCTCCTGG - Intronic
903373775 1:22853257-22853279 CCAAGTTCACGCCATTCTCCTGG - Intronic
904094565 1:27966888-27966910 CCTGAGTGACAGCATTCTCCTGG + Exonic
904148322 1:28414167-28414189 CTGGGTTCAAATGATTCTCCTGG + Intronic
904181134 1:28667548-28667570 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
904217974 1:28939535-28939557 CCGGGTTCAAGCGATTCTCCTGG + Intronic
904462542 1:30688786-30688808 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
904467594 1:30717746-30717768 CCGGGTTCACGCCGTTTTCCTGG + Intronic
904497781 1:30896867-30896889 CCGGGTTCAAGCAATTCTCCTGG - Intronic
904786054 1:32983894-32983916 CCGGGTTCACGCCATTCTCCTGG + Intergenic
905080681 1:35317337-35317359 CCGGGTTCAAGGGATTCTCTTGG - Intronic
905543473 1:38778992-38779014 CCGGGTTCACACCATTCTCCTGG + Intergenic
905671492 1:39793517-39793539 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
906001112 1:42426126-42426148 CCAGGTTCACGCCATTCTCCTGG + Intergenic
906019287 1:42613346-42613368 CCAGGTTCACGCCATTCTCCTGG + Intronic
906233035 1:44181957-44181979 CCAGGTTCACACCATTCTCCTGG + Intergenic
906510281 1:46406674-46406696 CCGGGTTCACGCCATTCTCCTGG + Intronic
907017792 1:51034240-51034262 CCGGGTTCAAGCAATTCTCCCGG + Intergenic
907059658 1:51408891-51408913 CTGGGTTCACACCATTCTCCTGG + Intronic
907152343 1:52300495-52300517 CCAGGTTCAAAAGATTCTCCTGG - Intronic
907215468 1:52859769-52859791 CCGGGTTCAAGTGATTCTCCTGG + Intronic
907225407 1:52941639-52941661 CTGGGTTCAAGCCATTCTCCTGG - Intronic
907436776 1:54454757-54454779 CCAGGTTCACGCCATTCTCCTGG + Intergenic
907633624 1:56109506-56109528 CCAGGTTCATGTCATTCTCCTGG - Intergenic
908123446 1:61007196-61007218 CCGGGTTCAAGCCATTCTCCTGG + Intronic
908150457 1:61295862-61295884 CTGGTTTCTCAGCATTGTCCAGG - Intronic
908311643 1:62890223-62890245 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
908344357 1:63216521-63216543 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
908345123 1:63224774-63224796 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
908647581 1:66295520-66295542 CCAGGTTCAAACAATTCTCCTGG + Intronic
909132733 1:71759389-71759411 CCGGGTTCAAGTGATTCTCCTGG + Intronic
909163307 1:72182397-72182419 CCGGGTTCAAATGATTCCCCTGG - Intronic
909634761 1:77805086-77805108 CTGGGTTCATGCCATTCTCCTGG + Intronic
910170684 1:84373555-84373577 CCAGTTTCACCGCATTATCCTGG - Intronic
910410196 1:86934832-86934854 CCAGGTTCACGCCATTCTCCTGG - Intronic
910654141 1:89603049-89603071 CCAGGGTCACAGCATCTTCCAGG - Intergenic
910696633 1:90025388-90025410 CCGGGTTCAAACGATTCTCCTGG + Intronic
910844447 1:91592193-91592215 CCGGGTTCACGCCATTCTCCTGG + Intergenic
912363386 1:109113297-109113319 CCGGGTTCAAGAGATTCTCCTGG - Intronic
912827480 1:112919122-112919144 CCGGGTTCACACCATTCTCCTGG + Intronic
912920938 1:113866415-113866437 CCGGGTTCAAGCTATTCTCCTGG - Intronic
914453919 1:147817555-147817577 CTGGGTTCACACCATTCTCCTGG - Intergenic
914685992 1:149980297-149980319 CAGGGTCCACAGCATGCACCTGG - Intronic
914796554 1:150924914-150924936 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
915364607 1:155307859-155307881 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
915365306 1:155311877-155311899 CCGGGTTCATGAAATTCTCCTGG - Intronic
915426352 1:155830369-155830391 CCGGGTTCAAGAGATTCTCCTGG + Intronic
915432118 1:155874794-155874816 CCGGGTTCAGGCCATTCTCCTGG - Intronic
916067740 1:161150173-161150195 CTGGGTTCATGCCATTCTCCTGG + Intergenic
916095811 1:161348742-161348764 CCAGGTTCAATTCATTCTCCTGG - Intronic
916100213 1:161388106-161388128 CCGGGTTCATGCCATTCTCCTGG + Intergenic
916793324 1:168143186-168143208 CTGGGTTCACGCCATTCTCCTGG - Intergenic
917194623 1:172452288-172452310 TCTGGGTCACAGCTTTCTCCTGG + Intronic
917305027 1:173616007-173616029 CTGGGTTCATGCCATTCTCCTGG - Intronic
917412134 1:174769757-174769779 CTGGGTTCACACCATTCTCCTGG - Intronic
917909624 1:179630071-179630093 CTGGGTTCATGCCATTCTCCGGG + Intronic
917938840 1:179895823-179895845 CCGGGTTCAAGTGATTCTCCCGG - Intronic
917951098 1:180037741-180037763 CCAGGTTCACGCCATTCTCCTGG + Intronic
919025076 1:192157813-192157835 CCAGGTTCAAGGGATTCTCCTGG + Intergenic
919582896 1:199399602-199399624 CCAGGTTCACACCATTCTCCTGG - Intergenic
919729429 1:200903388-200903410 CCAGGTTCAAGGGATTCTCCTGG - Intronic
919822412 1:201481601-201481623 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
920017040 1:202920468-202920490 CTGGGTTCATGCCATTCTCCTGG + Intronic
920198296 1:204243912-204243934 ATGGGTTCACGCCATTCTCCTGG + Intronic
920234882 1:204496235-204496257 CCGGGTTCACGCCATTCTTCTGG + Intergenic
920389247 1:205588728-205588750 CCCTGTTCTCAGCATTCTCCTGG + Intronic
920732942 1:208505087-208505109 CCGGGTTCAAGGGATTCTGCTGG + Intergenic
921018211 1:211211832-211211854 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
921020683 1:211232738-211232760 CCGGGTTCAAGAAATTCTCCTGG - Intergenic
921516767 1:216102704-216102726 TCGGGTTCACACCATTCTCCTGG - Intronic
921635489 1:217487517-217487539 CCGGGTTCAGGCGATTCTCCTGG + Intronic
922447963 1:225713480-225713502 CCTGGTTCAAGCCATTCTCCTGG + Intergenic
922681829 1:227604947-227604969 CCAGGTTCATGCCATTCTCCTGG + Intronic
923807048 1:237268840-237268862 CTGGGTTCAAGCCATTCTCCTGG - Intronic
924473517 1:244364196-244364218 CCGGGTTCACACCATTCTCCTGG + Intronic
924602663 1:245505030-245505052 CCGGGTTCAAGCGATTCTCCTGG + Intronic
924755818 1:246940078-246940100 CCGGGTTCAAGCCATTCTCGTGG + Intergenic
924807196 1:247370998-247371020 CCGGGTTCAAACAATTCCCCGGG - Intergenic
924871583 1:248052635-248052657 CCAGATTCACACCATTCTCCTGG - Intronic
924949698 1:248871336-248871358 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1063460080 10:6209856-6209878 CCAGGTTCACGCCATTCTCCTGG + Intronic
1063466883 10:6251872-6251894 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1063634531 10:7768921-7768943 CCAGGTTCAAATGATTCTCCTGG - Intronic
1064026812 10:11855378-11855400 CCGGGTTCACACCATTCTCCTGG - Intronic
1064046043 10:12016598-12016620 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1064182864 10:13134524-13134546 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1064233144 10:13547652-13547674 CTGGGTTCATGCCATTCTCCTGG - Intergenic
1064390032 10:14934232-14934254 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1064394025 10:14966155-14966177 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1064403833 10:15042952-15042974 CCGGGTTCACACCATTCTCCTGG + Intronic
1065258664 10:23901815-23901837 CCAGGTTCAAACGATTCTCCTGG - Intronic
1065352516 10:24808227-24808249 CCGGGTTCAAACGATTCTCTCGG + Intergenic
1065378115 10:25062950-25062972 CCGGGTTCAAGCTATTCTCCTGG + Intergenic
1065567117 10:27023246-27023268 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1065776509 10:29125379-29125401 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1066388723 10:34962117-34962139 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1066683658 10:37960006-37960028 CCGGGTTCACACCATTCTCCTGG + Intronic
1067302427 10:45024202-45024224 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1067584107 10:47465161-47465183 CCGGGTTCACGCCATTCTCCTGG + Intronic
1068181067 10:53519096-53519118 CCGGGTTCACGCTATTCTTCTGG - Intergenic
1068382424 10:56273992-56274014 CCGGGTTCACGCCGTTCTCCTGG - Intergenic
1068597454 10:58918334-58918356 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1069152838 10:64987015-64987037 CTGGCATCACAACATTCTCCAGG + Intergenic
1069417837 10:68217043-68217065 CCAGGTTCACGCCATTCTCCTGG - Intergenic
1069429162 10:68318131-68318153 CCAGGTTCTCACCATTCTCCTGG - Intronic
1069454144 10:68540500-68540522 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1069539958 10:69286640-69286662 CCAGGTTCAAGGGATTCTCCTGG + Intronic
1070104329 10:73417070-73417092 CCAGGTTCACACCATTCTCCTGG + Intergenic
1070165582 10:73895326-73895348 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1070623284 10:78030595-78030617 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1071866239 10:89735629-89735651 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1072037545 10:91577350-91577372 CTGGGTTCAAAAGATTCTCCTGG - Intergenic
1072106409 10:92278692-92278714 CCGGGTTCAAGCCATTCTCCTGG + Intronic
1072222019 10:93334665-93334687 CCGGCTTCAGTGCTTTCTCCTGG - Intronic
1072343139 10:94475522-94475544 CTGGGTTCAAACCATTCTCTTGG + Intronic
1073162663 10:101413405-101413427 CAGGGTTTACACCATTCTCCTGG + Intronic
1073244188 10:102077867-102077889 CTGGGTTCAAGGGATTCTCCTGG - Intergenic
1073367154 10:102952468-102952490 CCAGGTTCATGCCATTCTCCTGG - Intronic
1073400981 10:103257492-103257514 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1073655444 10:105410624-105410646 CCGGGTTCACGCAATTCTCCTGG + Intergenic
1073820162 10:107252896-107252918 CCAGGTTCAAGGGATTCTCCTGG + Intergenic
1074274314 10:111987047-111987069 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1074335387 10:112569059-112569081 CTGGGTTCAAATGATTCTCCTGG - Intronic
1074582263 10:114731232-114731254 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1074877697 10:117626975-117626997 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1075885119 10:125893335-125893357 CCGGGTTCACGCCATTCTCCTGG + Intronic
1076247118 10:128955968-128955990 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1076452509 10:130566544-130566566 GGGGGTTCACGCCATTCTCCTGG - Intergenic
1076659910 10:132048728-132048750 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1076918234 10:133437003-133437025 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1077054157 11:582356-582378 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1077122419 11:915925-915947 CCGGGGTCACGCCATTCTCCTGG - Intergenic
1078005147 11:7527007-7527029 CTGGGTTCACAGCATCCTAGAGG + Intronic
1078506614 11:11954361-11954383 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1079017832 11:16884539-16884561 CTGGGTTCAAACAATTCTCCTGG - Intronic
1079058459 11:17227683-17227705 CTGGGTTCACGCCATTCTCCTGG + Intronic
1079064306 11:17276458-17276480 CCTGCTCCACAGGATTCTCCGGG + Intronic
1079169475 11:18078742-18078764 CCGGGTTCACGCCATTCTCCTGG - Intronic
1079574294 11:21984271-21984293 CTGGGTTCACGCTATTCTCCAGG - Intergenic
1079624693 11:22602003-22602025 CCGGGTTCAAGGGATTCTCCTGG - Intergenic
1080362664 11:31533927-31533949 CCGGGTTCACGCCATTCTCCTGG + Intronic
1080559800 11:33452512-33452534 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1081256173 11:40898258-40898280 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1081429272 11:42957761-42957783 CCAGGTTCACGCCGTTCTCCTGG - Intergenic
1081835139 11:46147233-46147255 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1081865917 11:46360690-46360712 CCGGGTTCAGATGATTCTCCTGG - Intronic
1081897068 11:46595791-46595813 CGGGGTTCACCGCATTAGCCAGG - Intergenic
1082010279 11:47445500-47445522 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1082017962 11:47506331-47506353 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1082039973 11:47676723-47676745 CCGGGTTCAGGCCATTCTCCGGG - Intronic
1082747367 11:56979634-56979656 CCGGGTTCAAGGGATTCTCCTGG - Intergenic
1082788796 11:57332964-57332986 CAGGGTCCACACCATCCTCCTGG + Exonic
1082841993 11:57697367-57697389 CTGGGTTCACGCCATTCTCCTGG - Intronic
1082849916 11:57755225-57755247 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1082856232 11:57809801-57809823 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1083246459 11:61431788-61431810 CTGGGTTCACGCCAATCTCCTGG + Intronic
1083682069 11:64356076-64356098 CCAGGTTCAAACGATTCTCCTGG + Intronic
1084079530 11:66812268-66812290 CCGGGTTCACGCCATTCTTCTGG + Intronic
1084093468 11:66894606-66894628 CCGGGTTCCCACCATCCACCAGG + Intronic
1084131841 11:67142130-67142152 CCAGGTTCAAATGATTCTCCTGG + Intronic
1084152607 11:67297617-67297639 CCGGGTTCACGCCATTCTCCTGG + Intronic
1084369374 11:68729429-68729451 CCAGGTTCAAGCCATTCTCCTGG - Intronic
1084535789 11:69755895-69755917 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1084878498 11:72152524-72152546 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1084991647 11:72931186-72931208 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1085174313 11:74473283-74473305 CCAGGTTCCCAGCATTTTGCAGG + Intergenic
1085271901 11:75274696-75274718 CCAGGTTCATGCCATTCTCCTGG - Intronic
1085373915 11:76040377-76040399 CCAGGTTCACACCATTCTCCTGG - Intronic
1085608187 11:77921935-77921957 CCGGATTCAAATGATTCTCCTGG - Intronic
1086376582 11:86206895-86206917 CCGGGTTCACGCCATCCTCCTGG - Intergenic
1086406681 11:86504782-86504804 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1086467339 11:87068715-87068737 CCGGGTTTATGCCATTCTCCTGG - Intronic
1086859605 11:91909403-91909425 CAGGGTTCATGCCATTCTCCTGG - Intergenic
1087018870 11:93582256-93582278 CTGGGTTCATGCCATTCTCCTGG + Intergenic
1087291214 11:96322596-96322618 CCGGGTTCACGCCATTCTCCTGG - Intronic
1088017445 11:105077967-105077989 CCGGTTTCAAGGAATTCTCCTGG + Intronic
1088020013 11:105107954-105107976 CCAGGTTCAAGGAATTCTCCTGG + Intergenic
1088456131 11:110034693-110034715 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1088611153 11:111578296-111578318 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1088686072 11:112285488-112285510 CCGGGTTCAAGGGATTCTCCTGG + Intergenic
1089149195 11:116351742-116351764 CAGAATTCACAGCATTCTCATGG + Intergenic
1089197447 11:116702698-116702720 CTGGGTTTAAGGCATTCTCCTGG - Intergenic
1089445428 11:118548456-118548478 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1089486898 11:118853576-118853598 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1089514273 11:119022076-119022098 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1089927898 11:122278338-122278360 CTGGGTTCACACCATTCTCCTGG + Intergenic
1090020397 11:123123351-123123373 CCGGGTTCAAGCCATTCTCGTGG + Intronic
1090023701 11:123149902-123149924 CCGGGTTTAAATGATTCTCCTGG + Intronic
1090098358 11:123767241-123767263 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1090567543 11:128011476-128011498 CCGGGTTCATGCCATTCTCCTGG + Intergenic
1091235951 11:134022144-134022166 GCGGGTTCAAGCCATTCTCCTGG - Intergenic
1091411880 12:246222-246244 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1091557473 12:1585302-1585324 CCGGGTTCACGCCATTCTCCTGG - Intronic
1091872856 12:3909430-3909452 CCGGGTTCACGCCATTCCCCGGG - Intergenic
1092291882 12:7164494-7164516 CTGGGTTCATGCCATTCTCCTGG + Intergenic
1092354064 12:7779879-7779901 CCAGGTTCAAGGGATTCTCCTGG - Intergenic
1092459554 12:8674330-8674352 CCGGGCTCATGCCATTCTCCTGG + Intergenic
1092813532 12:12293012-12293034 CTGGGTTCACGTCACTCTCCTGG - Intergenic
1093200565 12:16181526-16181548 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1093556629 12:20483293-20483315 CGGGGTTCAAACAATTCTCCTGG - Intronic
1093881777 12:24412846-24412868 CTGGGTTCACACCATTCTCCTGG + Intergenic
1093945593 12:25105168-25105190 CTGGGTTCACGCCATTCTCCTGG + Intronic
1094034254 12:26049875-26049897 CCAGGTTCACACCATTCTCCTGG + Intronic
1094113404 12:26884583-26884605 CCAGGTTCACGCCATTCTCCTGG - Intergenic
1094154243 12:27320873-27320895 CCGGGTTCACGCCATTCTCCTGG + Intronic
1094242697 12:28247384-28247406 CCGGGTTCACGCCATTCTCCTGG - Intronic
1094301551 12:28970160-28970182 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1094428749 12:30343159-30343181 CTGGGTTCATGCCATTCTCCTGG - Intergenic
1094458369 12:30664831-30664853 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1094616042 12:32037356-32037378 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1095301160 12:40585707-40585729 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1096224382 12:49856270-49856292 CTGGGTTCAAACGATTCTCCTGG + Intergenic
1096278354 12:50230126-50230148 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1096373122 12:51084708-51084730 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1096584873 12:52613567-52613589 CTGGGAGCACAGCACTCTCCTGG - Intronic
1096679569 12:53246518-53246540 CCCGGTTCACACCATTCTCCTGG - Intergenic
1096703866 12:53406162-53406184 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1096856358 12:54487195-54487217 CCGGGTTCATGCCATTCTCCTGG + Intergenic
1097097583 12:56561899-56561921 CCGGGTTCACGCCATTCTCCTGG + Intronic
1097386441 12:58955576-58955598 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1097793869 12:63843030-63843052 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1097815385 12:64068202-64068224 CTCGGTTCACTGCAATCTCCCGG - Intronic
1097853929 12:64442212-64442234 CCGGGTTCAAGCAATTCTCCGGG + Intronic
1097885621 12:64725900-64725922 CCTGGTTCACGCCATTCTCCTGG - Intronic
1097893141 12:64798904-64798926 CCTGGTTCACGCCACTCTCCTGG + Intronic
1098278711 12:68840597-68840619 CCGGGTTCAAGCCATTCTCCTGG + Exonic
1098352655 12:69580601-69580623 CCAGGTTCATGCCATTCTCCTGG + Intergenic
1098544507 12:71696738-71696760 CCGGGTTCACACCATTCTCCTGG + Intronic
1098790056 12:74810689-74810711 CTGGGTTCACCCCATTCTCCTGG - Intergenic
1098848020 12:75561810-75561832 CCAGGTTCACTCCATTCTCTGGG + Intergenic
1098957502 12:76702776-76702798 CTGGGTTCAAGGGATTCTCCTGG + Intergenic
1099074741 12:78092591-78092613 CCGGGTTCACGCCATTTTCCTGG + Intronic
1099339258 12:81407387-81407409 CCAGGTTCAAGGGATTCTCCTGG - Intronic
1100166759 12:91924811-91924833 TCGGGTTCAAACAATTCTCCTGG - Intergenic
1100298569 12:93285697-93285719 CCAGGTTCAAGGGATTCTCCTGG - Intergenic
1100599565 12:96101457-96101479 CCAGGTTCAAATAATTCTCCTGG + Intergenic
1100918284 12:99453194-99453216 CCGGGTTCACACCATTCTCCTGG - Intronic
1101491743 12:105215931-105215953 CCGGGTTCACACCATTCTCCTGG - Intronic
1102132217 12:110540867-110540889 CTGGGTTCACGCCATTCTCCTGG + Intronic
1102310135 12:111838200-111838222 CCGGGTTCAGGTGATTCTCCTGG + Intergenic
1102371543 12:112385875-112385897 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1102690315 12:114755442-114755464 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1102754487 12:115326435-115326457 CTGGGTTCAAACGATTCTCCTGG + Intergenic
1102939162 12:116923615-116923637 CCGGGTTCACGCCATTCTCCTGG + Intronic
1102993032 12:117328262-117328284 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1103134093 12:118492683-118492705 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
1103525112 12:121562388-121562410 CCAGGTTCAAATGATTCTCCTGG - Intronic
1103525853 12:121567802-121567824 CCGGGTTCAAGCCATTCTCCGGG + Intronic
1103531095 12:121602390-121602412 CCTGGTTCAAGCCATTCTCCTGG + Intergenic
1103720687 12:122973765-122973787 CCGGGTTCACGCCATTCTCCTGG - Intronic
1103777469 12:123377068-123377090 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1103801662 12:123541879-123541901 CCGGGTTCAGGCCATTCTCCTGG - Intergenic
1103814077 12:123638887-123638909 CTGGGTTCACGCCATTCTCCTGG + Intronic
1104011949 12:124937382-124937404 CCAGGTTCACGCCATTCTCCTGG - Intergenic
1104861088 12:131924074-131924096 CCGGGTTCAAGCGATTCTCCAGG + Intergenic
1105293060 13:19065387-19065409 CCGGTTTCACGCCATTCTCCTGG - Intergenic
1105366455 13:19769639-19769661 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1106266104 13:28111802-28111824 CTGGGTTCACGCCATTCTGCTGG + Intergenic
1106274294 13:28189420-28189442 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1106288245 13:28336839-28336861 CTGGGTTCAAATGATTCTCCTGG + Intronic
1107785376 13:43951525-43951547 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1107886409 13:44877560-44877582 CTGGGTTCACGCCATTCTCTGGG - Intergenic
1107910915 13:45105098-45105120 CCAGGTTCACGCCATTCTCCTGG - Intergenic
1108094325 13:46884568-46884590 CCAGGTTCACGCCATTCTCCTGG - Intronic
1108150495 13:47528705-47528727 CCGGGTTCATGTGATTCTCCTGG - Intergenic
1108942809 13:55978135-55978157 CCGGGTTCACGCCATCCTCCTGG - Intergenic
1108945964 13:56024241-56024263 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1109019799 13:57074545-57074567 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1109087331 13:57991569-57991591 CCGGGTTCACACCATTCTCTTGG + Intergenic
1109125024 13:58506142-58506164 CCAGGTTCAAAGGATTCTCATGG - Intergenic
1110185432 13:72668529-72668551 CCAGGTTCAAGCCATTCTCCTGG - Intergenic
1110200868 13:72848736-72848758 CCGGGTTCATGCCATTCTCCTGG - Intronic
1110846354 13:80194474-80194496 CCAGGTTCACACCATTCTCCTGG - Intergenic
1111252938 13:85628590-85628612 CCGGGTCCACACCATTCTCCTGG + Intergenic
1111545465 13:89728386-89728408 CCAGGTTCACACCATTTTCCTGG + Intergenic
1112266357 13:97927360-97927382 CCGGGTTCATGCCATTCTCCTGG - Intergenic
1112269996 13:97959638-97959660 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1112351963 13:98642971-98642993 CTGGGTTCTCGCCATTCTCCCGG + Intergenic
1113230413 13:108207253-108207275 CCGGGTTCACACCACTCTCCTGG - Intergenic
1113366503 13:109681513-109681535 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1114143651 14:19947272-19947294 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1114251080 14:20961355-20961377 CCGGGTTCGCGCCATTCTCCTGG + Intergenic
1114318634 14:21528042-21528064 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1114347043 14:21807479-21807501 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1114384964 14:22244714-22244736 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1114470873 14:22960536-22960558 CTGGGTTGACGCCATTCTCCTGG - Intronic
1114519897 14:23326613-23326635 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1115218887 14:31039664-31039686 CCGGGTTCACGCCATTCTCCGGG + Intronic
1115250661 14:31343184-31343206 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1115255828 14:31400931-31400953 CTGGGTTCACGCCATTCTCCTGG + Intronic
1115497056 14:34015478-34015500 CCAGGTTCATGACATTCTCCTGG + Intronic
1115891429 14:38033695-38033717 CCGGGTTCACGCCATTCTCCTGG - Intronic
1116019517 14:39443175-39443197 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1116121853 14:40730897-40730919 CTGGGTTCATGCCATTCTCCTGG + Intergenic
1117017392 14:51532273-51532295 CTGGGTTCACGCCATTCTCCTGG - Intronic
1117392365 14:55273897-55273919 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1118100989 14:62602058-62602080 CCGGGTTCACGCCATTCTCCGGG - Intergenic
1118284769 14:64461509-64461531 CCTGTTGCACAGCATCCTCCAGG + Intronic
1119011221 14:70991296-70991318 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1120047874 14:79828524-79828546 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1120163995 14:81174570-81174592 CCGGGTTCACACCATTCTTCCGG - Intergenic
1120426865 14:84359662-84359684 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1120458007 14:84756791-84756813 CCAGGATCAAAGCATTCTCTAGG - Intergenic
1120620919 14:86763316-86763338 CCGGGTACACGCCATTCTCCTGG - Intergenic
1121196817 14:92080625-92080647 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1121216721 14:92254203-92254225 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1122789112 14:104176928-104176950 CCGGGTTCACAGCATGCGGAGGG - Exonic
1122964595 14:105116469-105116491 CCGGGTTCACACCATTCTCCTGG + Intergenic
1202872925 14_GL000225v1_random:180608-180630 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1123684150 15:22785889-22785911 CCGGGTTCACACCCTTCTCCTGG + Intronic
1123776155 15:23582834-23582856 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1123831594 15:24144981-24145003 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1124010145 15:25831381-25831403 CCCTGCTCGCAGCATTCTCCAGG - Intronic
1125133009 15:36306252-36306274 CCAGGTTCAAGGGATTCTCCAGG + Intergenic
1125161319 15:36647931-36647953 CCGGGCTCACGCCATTCTCCTGG + Intronic
1125286002 15:38093039-38093061 CCGGGTTCACGCCATTCTCCCGG - Intergenic
1125456336 15:39863151-39863173 CTGGGTTCATGCCATTCTCCTGG + Intronic
1125598413 15:40902204-40902226 CCAGGTTCACGCCATTCTCCTGG + Intronic
1125765931 15:42136335-42136357 CATGGTTCACGCCATTCTCCTGG + Intergenic
1125955625 15:43789053-43789075 CCGGGTTCACGCCATTCTCCTGG - Intronic
1125962247 15:43841294-43841316 CCAGGTTCATGCCATTCTCCTGG + Intronic
1126408823 15:48350876-48350898 CTGGGTTCACATGATTCTCCTGG + Intergenic
1126426462 15:48531788-48531810 CCCTGTTCACACCAGTCTCCAGG + Intronic
1127506282 15:59601052-59601074 CCGGGTTCATGCCGTTCTCCTGG + Intronic
1127694329 15:61429660-61429682 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1127796877 15:62446098-62446120 CCGGGTTCACGTCATTCTCCTGG + Intronic
1127830339 15:62744638-62744660 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1127835242 15:62785556-62785578 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1127943634 15:63727180-63727202 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1127948797 15:63783970-63783992 CCGGGTTCAAGCCATTCTCCTGG - Intronic
1128037219 15:64537405-64537427 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1128484210 15:68068987-68069009 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1128504792 15:68260396-68260418 CTGGGTTCACGCCCTTCTCCTGG + Intergenic
1128829754 15:70756777-70756799 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1128835104 15:70803196-70803218 CCAGGTTCACGCCATTCTCTGGG + Intergenic
1129425826 15:75462080-75462102 CCGGTTTCACGCCATTCTCCTGG + Intergenic
1129983130 15:79892855-79892877 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1130215644 15:81966280-81966302 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1130242646 15:82210766-82210788 CTGGGTTCAAACGATTCTCCAGG - Intronic
1130369676 15:83274289-83274311 CCAGGTTCACACCATTCTCCTGG - Intronic
1130749210 15:86692082-86692104 CCGGGTTCACACCATTCCAAAGG - Intronic
1130914622 15:88295150-88295172 CCGGGTACAGAGCATTCACTAGG + Intergenic
1131145967 15:90012384-90012406 CCGGGTTCACACCATTCCCCTGG + Intronic
1131146048 15:90013192-90013214 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1131200943 15:90395412-90395434 CCAGGTTAACGCCATTCTCCTGG + Intronic
1131227146 15:90634203-90634225 CCAGGTTCAAACCATTCTCCTGG + Intronic
1131348614 15:91675477-91675499 CCAGGTTCACACCATTCTCCTGG - Intergenic
1131840434 15:96430999-96431021 CCGGGTTCAAATGATTCTCCCGG + Intergenic
1132014379 15:98302792-98302814 CCTGGTTCAATGGATTCTCCTGG - Intergenic
1132495719 16:262371-262393 CCGGGTTCACAGCGTGACCCTGG + Intronic
1132519044 16:379025-379047 CCTGGGTCCCAGCCTTCTCCTGG + Intronic
1133049506 16:3109120-3109142 CCGGATTCACGCCATTCTCCTGG - Intergenic
1133524870 16:6594880-6594902 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1133773224 16:8879932-8879954 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1133801053 16:9085848-9085870 CGGGGTTCACGCCATTCTCTTGG + Intergenic
1134620262 16:15683435-15683457 CCAGGTTCATGCCATTCTCCTGG + Intronic
1134761699 16:16720352-16720374 CCTGGTTCATGCCATTCTCCTGG + Intergenic
1134984358 16:18638818-18638840 CCTGGTTCATGCCATTCTCCTGG - Intergenic
1135006804 16:18831660-18831682 CCGGGTTCAAGAGATTCTCCTGG - Intronic
1135050496 16:19188978-19189000 CCGGGTTCACGCCATTCTCCTGG + Intronic
1135466894 16:22694361-22694383 CTGGGTTCAAACGATTCTCCTGG + Intergenic
1135921594 16:26654043-26654065 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1135923173 16:26669334-26669356 CCGGTTTCAAGCCATTCTCCTGG - Intergenic
1136542254 16:30934562-30934584 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1138463488 16:57168707-57168729 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1138517693 16:57545917-57545939 CCGGGTTCAAACGATTCTCCTGG + Intronic
1138698188 16:58835312-58835334 CTGGGTTAACACCATTCTCCTGG + Intergenic
1138829794 16:60361252-60361274 CAGGTTTTTCAGCATTCTCCTGG + Intergenic
1139357524 16:66376015-66376037 CCAGGTTCAAGTCATTCTCCTGG - Intronic
1139425564 16:66877825-66877847 CCGGGTTCAAGCGATTCTCCCGG - Intergenic
1139442680 16:66976667-66976689 CCGGGTTCATGTGATTCTCCTGG - Intergenic
1139718192 16:68831170-68831192 CCAGGTTCACACCATTCTCCTGG + Intronic
1139905578 16:70363428-70363450 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1140356617 16:74312152-74312174 CCGGGTTCAGTAGATTCTCCTGG - Intergenic
1140441159 16:74988868-74988890 CCGGGTTCAAGCGATTCTCCCGG - Intronic
1140446607 16:75034062-75034084 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1140461843 16:75146254-75146276 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1140535291 16:75704254-75704276 CTGGGTTCACGCCATTCTCCTGG + Intronic
1141093067 16:81143660-81143682 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1141230262 16:82160665-82160687 CTGGGTGCACAGCATCCACCTGG + Intronic
1141537451 16:84692283-84692305 CCAGGTTCGCGCCATTCTCCTGG - Intergenic
1142036902 16:87868021-87868043 CCAGGTTCATGCCATTCTCCTGG - Intronic
1142298117 16:89240541-89240563 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1142341290 16:89524535-89524557 CCGAGTTCAAGGGATTCTCCTGG + Intronic
1142385502 16:89761323-89761345 CCGGGTTCACGCCATTCTCCTGG - Intronic
1142398472 16:89846605-89846627 CCGGGTTCACGCCATTCTCCTGG + Intronic
1142511049 17:393427-393449 CTGGGTTCAAACAATTCTCCTGG - Intergenic
1142832841 17:2562125-2562147 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1143112059 17:4558452-4558474 CGGGGCTCACAGCAGTCTGCAGG + Exonic
1143133328 17:4694913-4694935 CCGGGTTCAAGCGATTCTCCCGG - Intronic
1143192356 17:5049154-5049176 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1143278456 17:5731993-5732015 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1143302210 17:5918892-5918914 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1143392911 17:6570739-6570761 AAGGGTCCACAGCATTGTCCAGG + Intergenic
1143463628 17:7120744-7120766 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1143523274 17:7458064-7458086 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1143811636 17:9476544-9476566 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1144011772 17:11155678-11155700 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1144360319 17:14485901-14485923 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1144534506 17:16074959-16074981 CCGGGTTCACGCCATTCTCCTGG + Intronic
1144577882 17:16440759-16440781 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1146387599 17:32391158-32391180 CCGGGTTCACACTATTGTCCCGG + Intergenic
1146387782 17:32392599-32392621 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1146817134 17:35951635-35951657 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1146874980 17:36402358-36402380 CCGGGTTCACGCCATTCTCCTGG + Intronic
1146900182 17:36580299-36580321 CTGGGTTCACACCATTCTCCTGG + Intronic
1147064408 17:37910512-37910534 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1147346360 17:39798597-39798619 CCGGGTTCATGCCATTCTCTTGG + Intronic
1147684877 17:42281038-42281060 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1147750908 17:42732672-42732694 TGGGGTTCACGCCATTCTCCTGG - Intronic
1147905343 17:43818840-43818862 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1148283244 17:46365466-46365488 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1148305462 17:46583387-46583409 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1148507732 17:48141470-48141492 CTGGGTTCAAATGATTCTCCTGG + Intronic
1149160263 17:53685503-53685525 CCAGGTTCAAGGAATTCTCCTGG + Intergenic
1149856099 17:60084266-60084288 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1149990801 17:61382560-61382582 CTGGGTTCAAACAATTCTCCTGG - Intronic
1150051850 17:61971838-61971860 CTGGGTTCACACAATTCTCCTGG - Intronic
1150119002 17:62583669-62583691 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1150173014 17:63020018-63020040 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1151780929 17:76244845-76244867 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1151832633 17:76563876-76563898 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1152163098 17:78681742-78681764 CTGGGTTCACACCATTCTCCTGG - Intronic
1152296749 17:79471828-79471850 CCGGGATCCCACCGTTCTCCAGG + Intronic
1152607149 17:81297544-81297566 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1152793715 17:82296153-82296175 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1152825261 17:82460668-82460690 CCAGGTTCACGCCTTTCTCCTGG - Intronic
1152853709 17:82651733-82651755 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1152876840 17:82791183-82791205 CCGGGTTCACGCCATTCTCCTGG + Intronic
1153901249 18:9618729-9618751 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1154243952 18:12678860-12678882 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1154409327 18:14128197-14128219 CCAGGTTCATGCCATTCTCCTGG - Intronic
1155131515 18:22939430-22939452 CTGGGTTCAAACGATTCTCCTGG - Intronic
1155240980 18:23863349-23863371 CCAGGTTCAAATGATTCTCCTGG - Intronic
1155292511 18:24356080-24356102 CCAGGTTCAAGGAATTCTCCTGG - Intronic
1155940535 18:31798156-31798178 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1156238996 18:35233291-35233313 CCGGGTTCACGCCGTTCTTCTGG - Intergenic
1156321964 18:36034856-36034878 CTGAGTTCACATCATTCTCGAGG + Intronic
1157255112 18:46131817-46131839 CCGGGTTCAAGCGATTCTCCAGG - Intergenic
1157823640 18:50792571-50792593 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1158263718 18:55637018-55637040 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1158491432 18:57913394-57913416 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1158578262 18:58658580-58658602 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1158592957 18:58792726-58792748 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1158943952 18:62432231-62432253 CCTGGTTTACCCCATTCTCCTGG + Intergenic
1159349970 18:67259674-67259696 CTGTGGTTACAGCATTCTCCTGG - Intergenic
1159961505 18:74558953-74558975 GTGGGTTCTCAGCTTTCTCCAGG - Intronic
1160122820 18:76145785-76145807 CCGGAGTCAGAGCATTCTCTAGG - Intergenic
1160132452 18:76238618-76238640 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1160182662 18:76648862-76648884 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1160621545 18:80174565-80174587 CAGGGGTAACAGCATTATCCAGG + Intronic
1160669013 19:347766-347788 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1160791027 19:923852-923874 CCCGGATCACAGCTTCCTCCTGG + Intergenic
1160997590 19:1890707-1890729 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1161006301 19:1938683-1938705 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1161459289 19:4387028-4387050 CCGGGTTCACGCCATACTCCTGG + Intronic
1161464142 19:4418507-4418529 CCAGGTTCACGCCATTCTCCTGG + Intronic
1161466739 19:4435182-4435204 CCGGGTTCACACCATTCTTCTGG + Intronic
1161791167 19:6361220-6361242 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1161816815 19:6504250-6504272 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1162009756 19:7805395-7805417 CTGGGTTCACACCATTCTCCTGG + Intergenic
1162026525 19:7897261-7897283 CCGGGTTCCAACAATTCTCCTGG + Intronic
1162055424 19:8060772-8060794 CCGGGTTCACGCCATTCTCCTGG + Intronic
1162056638 19:8068295-8068317 CTGGGTTCATGCCATTCTCCTGG - Intronic
1162077528 19:8198015-8198037 CTGGGTTCAAGGGATTCTCCTGG - Intronic
1162113029 19:8411142-8411164 CCAGGTTCAAGGGATTCTCCTGG - Intronic
1162294317 19:9802629-9802651 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162339090 19:10080898-10080920 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1162405377 19:10469923-10469945 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1162429188 19:10617013-10617035 CCGGGTTCATGCCATTCTCCTGG + Intronic
1162489295 19:10982591-10982613 CTGGGTTCACACCATTCTCCTGG + Intronic
1162599985 19:11661576-11661598 CCGGATTCACTCCATTCTCCTGG + Intergenic
1162607205 19:11718714-11718736 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
1162763808 19:12905423-12905445 CCGGGTTCATGCCATTCTCCTGG + Intronic
1162907491 19:13832427-13832449 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1162942574 19:14022002-14022024 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1162983560 19:14254900-14254922 CCAGGTTCATGCCATTCTCCTGG + Intergenic
1162997301 19:14344252-14344274 CCAGGTTCACGCCATTCTCCTGG - Intergenic
1163106651 19:15126986-15127008 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1163182546 19:15614826-15614848 AATGGTGCACAGCATTCTCCTGG + Intergenic
1163341121 19:16707894-16707916 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1163405868 19:17121890-17121912 CCGGGCTCAAATGATTCTCCTGG - Intronic
1163458594 19:17423412-17423434 CCGGGTCCCCCGCCTTCTCCAGG + Intronic
1163656673 19:18550061-18550083 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1163707558 19:18824251-18824273 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1163770465 19:19188121-19188143 CTGGGTTCACGTCATTCTCCCGG + Intronic
1163793347 19:19321123-19321145 CCGCGCTCACCGCCTTCTCCAGG - Exonic
1163793688 19:19323078-19323100 ACGGGTTCACAGTATTGGCCAGG + Intronic
1163827474 19:19531823-19531845 CCGGGTTCAAGCGATTCTCCAGG + Intronic
1164077070 19:21828937-21828959 CCTGGTTCACGCCATTCTCCTGG - Intronic
1164274750 19:23706432-23706454 CCAGGTTCATGCCATTCTCCTGG - Intergenic
1165243625 19:34485174-34485196 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1166273976 19:41738330-41738352 CCGGGTTCATGCCATTCTCCTGG - Intronic
1166320612 19:42016325-42016347 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1166355255 19:42223545-42223567 CCAGGTTCAGGCCATTCTCCTGG - Intronic
1166431937 19:42735458-42735480 CTGGGTTCATGCCATTCTCCTGG + Intronic
1166481890 19:43181550-43181572 CTGGGCTCACGGCATTCTCCTGG + Intronic
1166917363 19:46204482-46204504 CCAGGGTCACAGGATTCTCATGG - Intergenic
1167076868 19:47255652-47255674 CGGGGTTCACGCCATTCTCCTGG + Intergenic
1167105049 19:47425253-47425275 CCAGGTTCACGCCATTCTCCTGG - Intergenic
1167203100 19:48081069-48081091 CCAGGTTCACGCCATTCTCCTGG - Intronic
1167236260 19:48317770-48317792 CCGGGTTTAAACGATTCTCCTGG + Intronic
1167332234 19:48863345-48863367 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1167467903 19:49659752-49659774 GCAGGTCCACAGTATTCTCCAGG + Exonic
1167709778 19:51103489-51103511 CCGGATTCACGCCATTCTCCTGG - Intronic
1167741171 19:51325754-51325776 ACGCGCTCACAGCATTCTCCTGG + Intronic
1167753282 19:51394003-51394025 CTGGGTTCTCATCAGTCTCCAGG - Intergenic
1167792595 19:51690858-51690880 CTGGGTTCCCAGCATGCCCCGGG - Intergenic
1167869691 19:52357549-52357571 CCGGGTTCAGGCCATTCTCCGGG - Intronic
1167947148 19:52997419-52997441 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1167994710 19:53392996-53393018 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1168003218 19:53465617-53465639 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1168016815 19:53580735-53580757 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1168085278 19:54041393-54041415 CCGGGTTCAAGCCATTCTCCTGG + Intronic
1168099890 19:54135574-54135596 CCGGGTTCAAGTGATTCTCCCGG + Intergenic
1168116843 19:54226646-54226668 CCGGGTTCACACCATTCTCCTGG + Intronic
1168214868 19:54918048-54918070 CCGGGATCACACCATTCTCCTGG + Intergenic
1168438913 19:56346800-56346822 CTGGGTTCACGCCATTCTCCTGG + Intronic
924973572 2:153580-153602 CCGGGTTCACGCCATACTCCTGG - Intergenic
925505126 2:4554142-4554164 CCAGGTTCACGCCATTCTCCTGG + Intergenic
926309268 2:11662685-11662707 CTGGGTTCACACCATTCTCCTGG - Intronic
927646967 2:24883984-24884006 CCTGAATCACAGCTTTCTCCTGG + Intronic
928641094 2:33300386-33300408 CAGGGAGCACTGCATTCTCCTGG + Intronic
928945886 2:36771430-36771452 CCGGGTTCAAGCGATTCTCCTGG - Intronic
928989723 2:37220221-37220243 CCGGGTTCAAGCCATTCTCCTGG - Intronic
929258712 2:39841199-39841221 CCGGGTTCACGCCATTCTCCTGG + Intergenic
929450982 2:42036896-42036918 CTGGGTTCACACCATTCTCCTGG - Intergenic
930193971 2:48489949-48489971 CTGGGTTCAAGCCATTCTCCTGG - Intronic
930196297 2:48514123-48514145 CCGGGTTCATGCCATTCTCCCGG + Intronic
931348459 2:61468276-61468298 CCGGGTTCAAGCAATTCTCCTGG + Intronic
931351139 2:61489982-61490004 CTGGGTTCAAGCCATTCTCCTGG + Intronic
931379172 2:61736236-61736258 CCAGTTTCACGCCATTCTCCTGG + Intergenic
931457101 2:62418967-62418989 CTGGGTTCATGCCATTCTCCTGG - Intergenic
931675784 2:64695022-64695044 CCGGGTTCAAGCAATTCTCCTGG + Intronic
931720285 2:65062437-65062459 CCGGGTTCAAGCAATTCTCCTGG - Intronic
932228071 2:70058978-70059000 CCAGGTTCACGCCATTCTCCTGG + Intergenic
932261137 2:70328646-70328668 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
932396269 2:71450826-71450848 CCAGGTTCACACCATTCTCCTGG + Intergenic
932663262 2:73675362-73675384 CCAGGTTCAAAGGATCCTCCCGG - Intergenic
932794921 2:74686191-74686213 CCGGGTTCACACCATTCTCCTGG + Intergenic
933126080 2:78607928-78607950 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
933288076 2:80406238-80406260 CCGGGTTCAAGTCATTCTCCTGG - Intronic
933716511 2:85365254-85365276 CCGGGTTCAAGTGATTCTCCTGG - Intronic
933785113 2:85832924-85832946 CTGGGTTCTCACCATTCTTCTGG - Intergenic
933998855 2:87689731-87689753 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
934311711 2:91872973-91872995 CTGGGTTCATGCCATTCTCCTGG - Intergenic
934584958 2:95483732-95483754 CCGGGTTCACGCCATTCTCCAGG - Intergenic
935228275 2:101073386-101073408 CTGGGTTCATGCCATTCTCCTGG + Intronic
935298311 2:101669999-101670021 CCGGGTTCACGCCATTCTCTTGG - Intergenic
935533450 2:104263629-104263651 CTGGGTTCACGCCATTCTCCAGG - Intergenic
935753406 2:106258842-106258864 CCAGGTTCAAATGATTCTCCTGG + Intergenic
936294991 2:111261152-111261174 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
936990109 2:118354759-118354781 CCGGTTTCACTGCATTGGCCAGG - Intergenic
937028303 2:118717536-118717558 CCGGGTTCATGCCATTCTCCTGG + Intergenic
937215467 2:120310070-120310092 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
937946368 2:127341624-127341646 CTGGGTTCACGCCATTCTCCTGG + Intronic
938293111 2:130160812-130160834 CTGGGTTCACTGCACTCTGCAGG - Intronic
938463443 2:131512153-131512175 CTGGGTTCACTGCACTCTGCAGG + Intergenic
938508590 2:131914420-131914442 CCGGGTTCAGGCCATTCTCCCGG + Intergenic
938822981 2:134977454-134977476 CCAGGTTCACACCATTTTCCTGG + Intronic
938871317 2:135480025-135480047 CTGGGTTCACGCCATTCTCCTGG + Intronic
938880574 2:135582235-135582257 CCGGGTTCAAGTGATTCTCCTGG - Intronic
939379439 2:141415106-141415128 CCGGGTTCACGCCATTCTCCTGG + Intronic
939979763 2:148765940-148765962 CCAGGTGCACGCCATTCTCCTGG - Intronic
940000468 2:148962257-148962279 CAGGGTTCAAGCCATTCTCCTGG + Intronic
941453249 2:165685448-165685470 CCTGGTTCCCATCATTCTACTGG - Exonic
941809926 2:169745417-169745439 CCGGGTTCACACCATTCTCCTGG - Intronic
942954420 2:181757720-181757742 CCGGGTTCACACCATTCTCCTGG - Intergenic
943053526 2:182946304-182946326 CCAGGTTCACGCCATTCTCCTGG - Intronic
943259973 2:185647111-185647133 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
943540163 2:189203989-189204011 CCGGGTTCACGCCATTCTCCTGG + Intergenic
944115166 2:196178084-196178106 CCCGGTTCACGCCATTCTCCTGG - Intergenic
944190440 2:196997541-196997563 CCGGGTTCAAACGATTCTCCTGG + Intronic
944711884 2:202341939-202341961 CTGGGTTCACGCCATTCTCCCGG - Intergenic
944722080 2:202433812-202433834 CCGGGTTCAAGCAATTCTCCTGG - Intronic
945232683 2:207608831-207608853 CCGTATTCACGCCATTCTCCTGG - Intronic
945332029 2:208551105-208551127 CCGGGTTCAAGTGATTCTCCTGG + Intronic
945625401 2:212198666-212198688 CCGGGTTCAAGCGATTCTCCTGG + Intronic
945738978 2:213637848-213637870 CCGGGTTCATGCCATTCTCCTGG + Intronic
946482533 2:220071012-220071034 CCAGGTTCAAATGATTCTCCTGG + Intergenic
946620457 2:221556388-221556410 CCAGGTTCAAACGATTCTCCTGG + Intronic
946795058 2:223341600-223341622 CCGGGTTCAAGCAATTCTCCAGG - Intergenic
946999032 2:225432061-225432083 CCAGGTTCATGCCATTCTCCTGG + Intronic
947225334 2:227834455-227834477 TGGGGTTCACGCCATTCTCCTGG + Intergenic
947627466 2:231629183-231629205 CCGGGTTCAAGGTCTTCTCCTGG - Intergenic
948938913 2:241186547-241186569 CCGGGTTCATGCCATTCTCCTGG - Intergenic
948985769 2:241522156-241522178 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1169451727 20:5717781-5717803 CCAGGTTCACGCCATTCTCCTGG + Intergenic
1169461383 20:5798709-5798731 CCAGGTTCACGCCATTCTCCTGG + Intronic
1169727408 20:8751027-8751049 CCGGGTTCACGCCATTCTCCTGG + Intronic
1170024865 20:11878375-11878397 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1170661348 20:18343501-18343523 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1171504348 20:25621646-25621668 CCGGGTTCACGCCATTCTCCTGG + Intronic
1171508846 20:25662935-25662957 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1172140335 20:32718308-32718330 CCGGGTTCACGCCATTCTCCTGG - Intronic
1172260412 20:33559578-33559600 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1172350393 20:34234718-34234740 CTGGGTTCAAATGATTCTCCTGG - Intronic
1172482350 20:35278252-35278274 GCGGGTTCCCAGCGTCCTCCTGG - Intergenic
1172551358 20:35802843-35802865 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1172626293 20:36349322-36349344 CCGGGTTCATGCCATTCTCCTGG - Intronic
1172678131 20:36689812-36689834 CTGGGTTCACGCCATTCTCCTGG + Intronic
1172737134 20:37135212-37135234 CCGGGTTCACGCCATTCTCCTGG - Intronic
1173736057 20:45362458-45362480 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1173802077 20:45900196-45900218 CCGGGTTCACGCCATTCTCCTGG + Intronic
1174662388 20:52224946-52224968 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1174786430 20:53437377-53437399 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1175420808 20:58831535-58831557 CCCGGTTCATGCCATTCTCCCGG - Intergenic
1175660726 20:60809838-60809860 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1176173460 20:63706998-63707020 CCGTCTTCCCAGCATTGTCCAGG + Exonic
1176426046 21:6548882-6548904 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1177340343 21:19790943-19790965 CTGGGTTCAGGCCATTCTCCTGG + Intergenic
1177368702 21:20173648-20173670 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1177440500 21:21116759-21116781 CTGGGTTCACACCATTCTCCTGG - Intronic
1177542395 21:22511508-22511530 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1177649794 21:23945989-23946011 CGGGGTTCACACTGTTCTCCTGG + Intergenic
1179351449 21:40615187-40615209 CCTGGTTCAAGGCATTCTCCTGG - Intronic
1179524906 21:41969611-41969633 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1179668079 21:42926145-42926167 CCGGGTTCAGGCCATTCTCCTGG - Intergenic
1179672094 21:42956458-42956480 CCAGGTTCAAGCCATTCTCCTGG - Intergenic
1179701537 21:43157199-43157221 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1180221332 21:46360314-46360336 CCGGGTTCATGCCATTCTCCTGG + Intronic
1180285176 22:10738902-10738924 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1180439477 22:15350656-15350678 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1180645511 22:17335403-17335425 CTCGGTTCACTGCAATCTCCTGG + Intergenic
1180660814 22:17465576-17465598 CTGGGTTCAAACGATTCTCCTGG + Intronic
1180866591 22:19123021-19123043 CCGGCTTCGCTGCAGTCTCCAGG - Intergenic
1181809847 22:25396964-25396986 CCGGATTCAAGCCATTCTCCTGG - Intronic
1182238429 22:28895377-28895399 CCGGAGTCACAGCATTTTCAAGG - Intronic
1182306808 22:29375424-29375446 CTGGGTTGACAGCATTCAACAGG - Intronic
1182641933 22:31775136-31775158 CATGGTACACAGCATTTTCCTGG + Intronic
1182819520 22:33203348-33203370 CCTGGTTCCCGGCATTCTCCTGG - Intronic
1183527261 22:38330719-38330741 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1183589282 22:38770429-38770451 CCGGGTACCCAGCACTCTCCTGG + Intronic
1183984899 22:41563988-41564010 CCAGGTTCCCGCCATTCTCCTGG - Intronic
1184194946 22:42921263-42921285 CTGGGTTCAAATGATTCTCCTGG - Intronic
1184337660 22:43863347-43863369 CCGGGTTTACGCCATTCTCCTGG + Intergenic
1184439433 22:44499730-44499752 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1184476403 22:44724359-44724381 CCGGGTTCACCGCAACCTCTAGG + Intronic
1184535019 22:45080907-45080929 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1184905061 22:47477121-47477143 CAGGTTTCACCGCATTGTCCAGG + Intronic
1185397291 22:50599635-50599657 CCGGGTTCAAATGATTCTCCTGG + Intronic
1203216119 22_KI270731v1_random:6961-6983 TGGGGAACACAGCATTCTCCAGG + Intergenic
950056631 3:10030188-10030210 CCGGGTTCAAGCGATTCTCCTGG + Intronic
950205000 3:11072675-11072697 CCGGGTTCACACCATTCTTCTGG + Intergenic
950492161 3:13312403-13312425 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
951795606 3:26534627-26534649 CCAGGTTCAAATGATTCTCCTGG + Intergenic
951930639 3:27963302-27963324 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
952345027 3:32475507-32475529 CCGGGTTCACGCCATTCTCCTGG + Intronic
952372959 3:32740766-32740788 CCAGGTTCACGCCATTCTCCTGG - Intronic
952436321 3:33276156-33276178 CTGGGTTCACGCCATTCTCCTGG + Intergenic
953174838 3:40541237-40541259 CCGGGTTCACGCCATTCTCCTGG - Intronic
953587904 3:44221829-44221851 CCGGGTTCACGTCATTCTCCTGG + Intergenic
953914911 3:46912229-46912251 CCTGGTTCACGCCATTCTCCTGG - Intergenic
954012374 3:47653048-47653070 CCGGGTTCACGCCATTCTCCTGG + Intronic
954031458 3:47822997-47823019 CCAGGTTCACACCATTATCCTGG - Intronic
955205890 3:56895555-56895577 CTGGGTTCACGCCATTCTCCTGG + Intronic
955539255 3:59956572-59956594 CCGGGTTCAAGCAATTCTCCTGG - Intronic
956318737 3:67970784-67970806 CTGGGTTCAAGGGATTCTCCTGG + Intergenic
958614743 3:96478099-96478121 CCGGGTTCAAGGGATCCTCCTGG + Intergenic
959150298 3:102599791-102599813 CCGGGTTCATGCCATTTTCCTGG + Intergenic
959178725 3:102951296-102951318 CCAGGTTCAATCCATTCTCCTGG - Intergenic
959404898 3:105949331-105949353 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
960134940 3:114095419-114095441 CCGGGTTCATGCCATTCTCCCGG - Intergenic
960361204 3:116713870-116713892 CCGGGTTCAAGTGATTCTCCTGG - Intronic
960585476 3:119317270-119317292 CTGGGTTCACGCTATTCTCCTGG + Intronic
960641966 3:119833787-119833809 CTGGGTTCAAGGGATTCTCCTGG + Intronic
960687128 3:120306237-120306259 CCGGGTTCATGCCATTCTCCTGG - Intergenic
960935677 3:122899968-122899990 CCTGGTTCAAGGAATTCTCCTGG - Intergenic
961252940 3:125521918-125521940 CGGGGTTCACCGTATTGTCCAGG - Intergenic
961263877 3:125624700-125624722 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
961697637 3:128716876-128716898 CCGGGTTCAATTGATTCTCCTGG + Intergenic
962514478 3:136137633-136137655 CCAGGTTCAGGCCATTCTCCTGG + Intronic
962542845 3:136400627-136400649 CCGGGTTCAAGTGATTCTCCTGG + Intronic
962732332 3:138294990-138295012 CCAGGTTCAGGCCATTCTCCTGG + Intronic
962792542 3:138824597-138824619 CCGGGTTCAAGTGATTCTCCTGG - Intronic
962795745 3:138848093-138848115 CCGGTTTCACGCCATTCTCCTGG + Intergenic
962800070 3:138882859-138882881 CCGGGTTCAAGCGATTCTCCCGG + Intergenic
963301768 3:143605393-143605415 TGGGGTTCCCATCATTCTCCTGG - Intronic
963511156 3:146250967-146250989 CCCGGTGCCCAGCATTCTGCGGG - Exonic
963519836 3:146349796-146349818 CCAGGTTCACGCCATTCTTCTGG - Intergenic
964349432 3:155788095-155788117 CCAGGTTCACGCCATTCTCCTGG - Intronic
964671242 3:159228707-159228729 CCGGGTTCACGCCACTCTCCTGG - Intronic
965033395 3:163403118-163403140 CTGGGTTCAGACGATTCTCCTGG + Intergenic
965635356 3:170775113-170775135 CCGGGTTCAAGCAATTCTCCGGG + Intronic
965873343 3:173286694-173286716 CCGGGTTCGCGCCATTCTCCCGG - Intergenic
965964229 3:174467497-174467519 CCGGGTTCAAGCAATTCTCCTGG - Intronic
966185721 3:177224994-177225016 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
966209196 3:177435178-177435200 CCGGGTTCACGCCATTCTCCTGG + Intergenic
966453678 3:180091450-180091472 CCGGGTTCAGATGATTCTCCTGG + Intergenic
966619233 3:181946065-181946087 CTGGGTTCACGCCATTCTCCTGG + Intergenic
967123607 3:186405533-186405555 ACAGGTTCACAGAATTCTTCGGG - Intergenic
967588326 3:191241270-191241292 CCGGGTTCACGCCATTCTCCTGG + Intronic
968315102 3:197717348-197717370 CCGGGTTCACAGCATTCTCCTGG - Intronic
968874718 4:3259949-3259971 CTGGGTTCACGCCATTCTCCTGG - Intronic
969273593 4:6119448-6119470 CCGGGTTCAAGCGATTCTCCTGG - Intronic
969412576 4:7038993-7039015 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
969671990 4:8594864-8594886 CCGGGTTCACGCCATTCTCCTGG + Intronic
970092735 4:12428542-12428564 CCGGGTTCAGGCCATTCTCCTGG + Intergenic
970541407 4:17083579-17083601 CCAGGTTCACGCCATTCCCCTGG - Intergenic
971737561 4:30475287-30475309 CTGGGTTCACACGATTCTCCTGG - Intergenic
971906149 4:32728449-32728471 CTGGGTTCACAAAATTCTCCTGG - Intergenic
972481363 4:39499934-39499956 CCAGGTTCACGCCATTCTCCTGG - Exonic
972555405 4:40175994-40176016 CCGGGTTCACGCCATTCTCCTGG - Intergenic
972595946 4:40530027-40530049 CCGGGTTCAAGCGATTCTCCTGG + Intronic
972779530 4:42274403-42274425 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
972800655 4:42472648-42472670 CCAGGTTCACGCAATTCTCCTGG - Intronic
973152653 4:46907945-46907967 CCGGGTTCAAGCGATTCTCCCGG + Intronic
973562101 4:52147539-52147561 CCAGGTTCAAGCCATTCTCCTGG + Intergenic
973610741 4:52634205-52634227 CTGGGTTCAAACAATTCTCCTGG + Intronic
974029076 4:56759761-56759783 CTGGGTTCACGTCATTCTCCTGG + Intergenic
974712132 4:65611921-65611943 CCAGGTTCACGCCATCCTCCTGG - Intronic
975135947 4:70874648-70874670 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
976125747 4:81832348-81832370 CAGGGTGCACAGCAAACTCCCGG + Intronic
976197868 4:82550694-82550716 CTGGGTTCACGCCATTCTCCTGG - Intronic
976640794 4:87335843-87335865 CGGGGTTCAAATGATTCTCCTGG + Intergenic
976960394 4:90964629-90964651 CCGGGTTCATGCCATTCTCCTGG - Intronic
977676821 4:99757279-99757301 CCTGGTTCAAATGATTCTCCTGG + Intergenic
978251267 4:106634085-106634107 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
978256334 4:106696870-106696892 CCGGGTTCACGCCATTCTCCTGG - Intergenic
978569478 4:110120892-110120914 CCGGGTTCAAGCGATTCTCCTGG + Intronic
978792014 4:112672488-112672510 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
978959641 4:114660795-114660817 CTGGGTTCACGCCTTTCTCCTGG - Intronic
979840100 4:125428202-125428224 CCGGGTTCAAGCGATTCTCCTGG - Intronic
980050875 4:128038814-128038836 CCGGGTTCAAGCGATTCTCCTGG - Intronic
980051376 4:128043568-128043590 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
980293622 4:130879035-130879057 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
980921745 4:139093057-139093079 CCGGGTTCACGCCATCCTCCTGG + Intronic
981526692 4:145713874-145713896 CTGGGTTCAAATGATTCTCCTGG + Intronic
982435304 4:155378189-155378211 CCAGGTTCACCTCATGCTCCTGG + Intergenic
982696931 4:158612702-158612724 CTGGGTTCAAGCCATTCTCCTGG + Intronic
983568891 4:169183372-169183394 CCGGGTTCAAGTGATTCTCCTGG + Intronic
983770826 4:171547000-171547022 CAGGGTTCACGCCATTCTCCTGG + Intergenic
984183391 4:176512678-176512700 CCGGGTTCACGCCATTCTCCTGG + Intergenic
984230022 4:177084402-177084424 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
984268322 4:177520476-177520498 CCGGGTTCACATCATTCTCCTGG - Intergenic
984392895 4:179160723-179160745 CCGGGTTCACGCCATTCTCCTGG + Intergenic
984544891 4:181089626-181089648 CCAGGTTCACGCCATTCTCCTGG - Intergenic
984627592 4:182025120-182025142 GCGGGTTCACGCCATTCTCCTGG + Intergenic
984746185 4:183220738-183220760 CCGGGTTCACGCCATTCTCCTGG - Intronic
984806069 4:183753093-183753115 CCGGGTTCACGCCATTCTCCTGG + Intergenic
984937848 4:184904914-184904936 CCGGGTTCAAACAATTCTCCTGG - Intergenic
984973167 4:185208632-185208654 CTGGGTTCAAGCCATTCTCCTGG - Intronic
984989666 4:185368082-185368104 CCAGGTTCACGCCATTCTCCTGG - Intronic
985476248 5:80914-80936 GCAGGTTCCCAGTATTCTCCAGG + Intergenic
985476274 5:81085-81107 GCAGGTTCCCAGTATTCTCCAGG + Intergenic
985661784 5:1160926-1160948 CTGGGTTCACGCCATTCTCCTGG - Intergenic
987569594 5:19639094-19639116 CTGGGCTCACGCCATTCTCCTGG + Intronic
987877573 5:23698573-23698595 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
988311808 5:29568641-29568663 CCGGGTTCAGGCAATTCTCCTGG + Intergenic
988512751 5:31879291-31879313 CCAGGTTCACGCCATTCTCCAGG - Intronic
989077824 5:37583325-37583347 CTGGGTTCACGCCATTCTCCTGG - Intronic
989082128 5:37634203-37634225 CTGGGTTCACACCATTCTCCTGG - Intronic
989131806 5:38114412-38114434 CCGGGTTCATGCCATTCTCCTGG + Intergenic
989397041 5:40968217-40968239 CCAGGTTCAAACAATTCTCCTGG + Intronic
990002853 5:50914662-50914684 CCAGGTTCAAACGATTCTCCTGG - Intergenic
990101994 5:52202274-52202296 CCGGATTCACGCCATTCTTCTGG + Intergenic
990468312 5:56089961-56089983 CTGGGTTCAAACAATTCTCCTGG + Intergenic
991367630 5:65885745-65885767 CCGGGTTCATGCCTTTCTCCTGG + Intergenic
991943104 5:71874034-71874056 CCGGGTTCATGCCATTCTCCTGG + Intergenic
992053559 5:72964475-72964497 CCGGGTTCAAGTGATTCTCCTGG + Intronic
992240615 5:74765903-74765925 CCGGGTTCAAGCGATTCTCCAGG - Intronic
992253257 5:74896535-74896557 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
992536777 5:77714224-77714246 CCGGGTTCAAGCGATTCTCCTGG - Intronic
992683816 5:79180256-79180278 CCAGGTTCACGCCATTCTCCTGG - Intronic
992806763 5:80345278-80345300 CCGGGTTCAAGCCATTGTCCTGG - Intergenic
993076572 5:83239733-83239755 CTGGGTTCACACCATTCCCCTGG - Intronic
993993094 5:94684602-94684624 CCGGGTTCACACCATTCTCCTGG - Intronic
994071574 5:95608804-95608826 CCGGGTTCAAACGATTCTCCTGG - Intergenic
994419506 5:99514940-99514962 CCGGATTCATGCCATTCTCCTGG + Intergenic
994869467 5:105327799-105327821 CCGGGTTCATGCCATTCTCCTGG - Intergenic
994912360 5:105927803-105927825 CCGGGTTCACGCCATTCTCCTGG - Intergenic
997300385 5:132799335-132799357 CCGGGTTCAAACGATTCTCCTGG - Intronic
997306056 5:132837434-132837456 CCGGGTCCACGCCATTCTCCTGG + Intergenic
997324013 5:133004580-133004602 CCGGGTTCACGCCATTCTCCTGG + Intronic
997553196 5:134771606-134771628 CCGGGTTCACACCATTCTCCTGG - Intronic
997973808 5:138426479-138426501 CCAGGTTCATGCCATTCTCCTGG - Intronic
998588131 5:143449647-143449669 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1000068783 5:157719855-157719877 TCAGGTTCACCCCATTCTCCTGG - Intergenic
1000500543 5:162043653-162043675 CCAGGTTCACGCTATTCTCCTGG + Intergenic
1001389876 5:171370247-171370269 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1001466269 5:171969172-171969194 CTGGGTTCACATGATTCTTCTGG - Intronic
1001697826 5:173685484-173685506 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1002123178 5:177021744-177021766 CCGGGTTCAAGCCATTCTCCTGG + Intronic
1002166822 5:177352721-177352743 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1003938410 6:10999467-10999489 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1004323022 6:14647864-14647886 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1004347646 6:14863415-14863437 CCTGGGTCACTGCTTTCTCCTGG - Intergenic
1005019537 6:21404481-21404503 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1005383262 6:25259713-25259735 CTGGGTTCAAGGAATTCTCCTGG - Intergenic
1005513661 6:26534383-26534405 CCAGGTTCACGCCATTCGCCTGG - Intergenic
1005576161 6:27191311-27191333 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1005578115 6:27208836-27208858 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1005580355 6:27228282-27228304 CCGAGTTCACTCCATTCTCCTGG - Intergenic
1005613695 6:27552539-27552561 CCGGGTTCGCGCCATTTTCCTGG + Intergenic
1005748030 6:28857607-28857629 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1005842674 6:29754155-29754177 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1006025469 6:31143963-31143985 CCGGGTTCAAGCCATTCTCCTGG - Intronic
1006546326 6:34784936-34784958 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1006856722 6:37138648-37138670 CCGGGTTCATCCCATTCTCCTGG - Intergenic
1007003282 6:38335344-38335366 CTGGGTTCAAAGGATTCTCATGG + Intronic
1007580809 6:42958839-42958861 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1007580984 6:42960102-42960124 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1007604796 6:43109790-43109812 CCGGGTTCACACCATTCTCCTGG + Intronic
1008324561 6:50162011-50162033 CCAGGTTCACACCATTCTCCTGG + Intergenic
1008516008 6:52319863-52319885 CCGGGTTCAAGGGATTCCCCCGG + Intergenic
1008535259 6:52502519-52502541 CCGAGTTCACACCATCCTTCTGG + Exonic
1008924830 6:56880939-56880961 CTGGGTTCATGCCATTCTCCTGG + Intronic
1009434675 6:63604073-63604095 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1011225449 6:85100310-85100332 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1012309239 6:97700602-97700624 CCGGGTTCACGTCATTCTCCCGG - Intergenic
1012450233 6:99347306-99347328 CCTGGTTCAAATGATTCTCCTGG - Intronic
1013574260 6:111465172-111465194 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1014208095 6:118678836-118678858 CCGGGTTCAAGAGATTCTCCTGG - Intronic
1014376152 6:120677443-120677465 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1014457111 6:121648750-121648772 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1014634930 6:123833819-123833841 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1014659931 6:124157007-124157029 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1014932813 6:127353888-127353910 CCAGGTTCACACCATTTTTCTGG - Intergenic
1015322685 6:131894045-131894067 CCAGGTTCACGCCATTCTCCTGG + Exonic
1015649527 6:135440246-135440268 CCTGGCTCACAGCATGCTCTGGG + Intronic
1015844669 6:137507499-137507521 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1015851974 6:137583603-137583625 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1016022220 6:139248177-139248199 CCAGGTTCACGCCATTCTCCTGG - Intronic
1016269115 6:142268288-142268310 CCAGGTTCAAACGATTCTCCTGG + Intergenic
1017329010 6:153173773-153173795 CCGGGTTCAGGCCATTCTCCTGG - Intergenic
1017499195 6:155007476-155007498 CCGGGTTCACGCCATTCTTAAGG + Intronic
1017557605 6:155588944-155588966 CTGGGTTCACACCATTCTCTTGG + Intergenic
1017693138 6:156987422-156987444 CCGGGTTCGCGCCATTCTCCTGG + Intronic
1017761692 6:157574327-157574349 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1017878309 6:158541997-158542019 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1017937668 6:159020918-159020940 CTGGGTTCACGCCATTTTCCTGG + Intergenic
1018205312 6:161431704-161431726 CCGGGTTCAAGAGATTCTCCTGG + Intronic
1018544746 6:164923119-164923141 CTGGGTTCACGCCATTCTCCTGG - Intergenic
1018549856 6:164983283-164983305 CCGGGTTCACGCCATTCTTCTGG - Intergenic
1018695825 6:166390703-166390725 CTGGCTTCACAACATCCTCCCGG - Intergenic
1019928580 7:4208897-4208919 GCAGCTTCACAGCATCCTCCAGG - Intronic
1020040415 7:4996968-4996990 CCTGAGTGACAGCATTCTCCTGG + Intronic
1020073003 7:5239804-5239826 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1020201026 7:6080127-6080149 CCGGATTCATGCCATTCTCCTGG - Intergenic
1020247487 7:6441182-6441204 CCAGGTTCATGCCATTCTCCTGG + Intronic
1020510123 7:9046041-9046063 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1020594149 7:10183226-10183248 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1020745929 7:12077830-12077852 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1020947934 7:14638942-14638964 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1020981505 7:15075118-15075140 CCAGGTTCAAATGATTCTCCTGG - Intergenic
1021030596 7:15729056-15729078 CCAGGTTCATGCCATTCTCCTGG - Intergenic
1021139925 7:17011761-17011783 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1021300683 7:18968863-18968885 CCGGGTTCACACCATTCTCCTGG - Intronic
1021724181 7:23533667-23533689 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1022889200 7:34678313-34678335 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1023130595 7:36999096-36999118 CCGGGGCCACAGCATTGTCTAGG + Intronic
1023149828 7:37191822-37191844 CCGGGTTCATGGAATTCTCCTGG - Intronic
1023253587 7:38290934-38290956 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1023444164 7:40214818-40214840 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1023471898 7:40531765-40531787 CCGGGTTCCCGCCATTCTTCTGG + Intronic
1023916660 7:44594921-44594943 CCGGGTTCAAGAGATTCTCCTGG - Intergenic
1023926101 7:44670915-44670937 CCGGGTTCATGCCATTCTCCTGG - Intronic
1024929879 7:54658635-54658657 CTGTGGTCATAGCATTCTCCTGG - Intergenic
1025032341 7:55568171-55568193 CCGGGTTCACGCCATTCTCCAGG + Intronic
1025803016 7:64805303-64805325 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1026041113 7:66868993-66869015 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1026386191 7:69850328-69850350 CCGGGCTCACTGCAACCTCCGGG - Intronic
1026718562 7:72811175-72811197 CTGGGTTCACGCCATTCTCTTGG - Intronic
1026768608 7:73177413-73177435 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1026832621 7:73619365-73619387 CCGGGTTAACGCCATTCTCCTGG - Intronic
1027009478 7:74730798-74730820 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1027078565 7:75215244-75215266 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1027173112 7:75886718-75886740 CCAGGTTCACACCATTCTCCTGG - Intronic
1027515705 7:79138880-79138902 CCGGGTTCACGCCATTCTACAGG - Intronic
1027523419 7:79237397-79237419 CCGGGTTCATGCCATTCTCCTGG - Intronic
1027788315 7:82608424-82608446 CTAGGTTCACGCCATTCTCCTGG + Intergenic
1027960205 7:84936648-84936670 CCAGGTTCATGCCATTCTCCTGG + Intergenic
1028445324 7:90915343-90915365 CCGGGTTCATGCCATTCTCCTGG - Intronic
1029542602 7:101192982-101193004 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1029734667 7:102459050-102459072 CCGGGTTCAAGCCATTCTTCTGG - Intronic
1030022389 7:105288498-105288520 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1030204806 7:106942472-106942494 CTGGGTTCACACCATTCTCCTGG + Intergenic
1030260747 7:107561880-107561902 CGGGGTTCACGCCATTCTCCTGG - Intronic
1030306144 7:108020375-108020397 CCAGGTTCAAACGATTCTCCTGG - Intergenic
1030506288 7:110427692-110427714 CCGGGTTCAAATGATTCTCGTGG + Intergenic
1030704614 7:112678552-112678574 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1030980325 7:116178593-116178615 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1031060884 7:117050119-117050141 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1031965105 7:128022109-128022131 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1032021838 7:128410994-128411016 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1032147367 7:129396214-129396236 CCAGGTTCACACCATTCTCCTGG + Intronic
1032167276 7:129555501-129555523 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1032718450 7:134530765-134530787 CCCGCTTCACAGCCTTCTCTTGG - Exonic
1033202608 7:139386496-139386518 CCGGGTTCACACCATTCTCCTGG + Intronic
1033265681 7:139884659-139884681 CCTGGTGCACAGCTCTCTCCTGG - Intronic
1033343539 7:140510242-140510264 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1033676621 7:143546438-143546460 CCGGGTTAACGCCATTCTCCTGG + Intergenic
1033695212 7:143782995-143783017 CCGGGTTAACGCCATTCTCCTGG - Intergenic
1033754239 7:144384808-144384830 TCTGGCTCACAGCATTCTCCAGG + Intergenic
1033971647 7:147048166-147048188 CCGGGTTCACGCCATTCTCCTGG + Intronic
1033977884 7:147124972-147124994 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1035367213 7:158357144-158357166 CCGTGTTCACATCATTCGTCCGG - Intronic
1036143713 8:6232473-6232495 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1036166297 8:6437322-6437344 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1036589119 8:10151554-10151576 CCGGGTTCACACCATTCTCCTGG - Intronic
1036730303 8:11257023-11257045 ACGGGTTGAAGGCATTCTCCAGG + Intergenic
1037112876 8:15186166-15186188 CCGGGTTCATGCCATTCTCCTGG - Intronic
1037194642 8:16173740-16173762 CTGGGTTCACGCCATTCTCCTGG + Intronic
1037964695 8:23125072-23125094 CCGGGTTCAAGCCATTCTTCTGG + Intergenic
1038141914 8:24855064-24855086 CCGGATTCAAGCCATTCTCCTGG + Intergenic
1038270450 8:26070858-26070880 CCGGGTTCAAGAGATTCTCCTGG + Intergenic
1038619115 8:29123354-29123376 CAGGGTTCATACCATTCTGCTGG + Exonic
1038809912 8:30829724-30829746 CCAGGTTCAAACGATTCTCCTGG - Intergenic
1039245693 8:35606079-35606101 CTGGGTTCAAATGATTCTCCTGG + Intronic
1039541183 8:38372588-38372610 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1039995239 8:42526577-42526599 CTGGGTTCACGCCATTCTCCTGG - Intronic
1040059091 8:43088831-43088853 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1040948215 8:52907491-52907513 CAGGGTTCACACCATTCTCCTGG + Intergenic
1041052592 8:53952169-53952191 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1041063612 8:54060217-54060239 CCAGGTTCAAACAATTCTCCTGG + Intronic
1041178010 8:55217146-55217168 CCGGGTTCATGCCATTCTCCTGG - Intronic
1042232710 8:66574958-66574980 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1042245434 8:66705375-66705397 CCGAGTTCACACCATTCTCCTGG + Intronic
1042543637 8:69931461-69931483 CCTGGTTCACCTTATTCTCCAGG - Intergenic
1042727195 8:71890717-71890739 CCAGGTTCACACCATTCTCATGG - Intronic
1043431749 8:80201764-80201786 CCGGGCTCACGCCATTCTCCTGG - Intronic
1043456763 8:80419538-80419560 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1044078507 8:87855194-87855216 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1044162958 8:88943495-88943517 CCAGGTTCAAATGATTCTCCAGG - Intergenic
1044372263 8:91425772-91425794 CCTGGTTCACGTCATTCTCCTGG - Intergenic
1044498123 8:92915583-92915605 CCGGGTTCACGCCATTCTCCTGG + Intronic
1044632566 8:94293349-94293371 GGGGGTTCACAGCTTTCTGCTGG + Intergenic
1044989892 8:97786603-97786625 CCAGGTTCACGTGATTCTCCGGG - Intronic
1045961409 8:107973174-107973196 CCGGGTTCACGCCATACTCCTGG - Intronic
1046161842 8:110376605-110376627 CCGGATTCACGCCATTCTCCTGG + Intergenic
1046293285 8:112190148-112190170 CCAGGTTCACACCATTCTCCTGG - Intergenic
1046361638 8:113166409-113166431 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1046991801 8:120466303-120466325 CCGGGTTCAAGCAATTCTCCCGG + Intronic
1046994460 8:120501266-120501288 CCAGGTTCACGCCATTCTCCTGG - Intronic
1047001643 8:120579081-120579103 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1047093322 8:121597034-121597056 CTGGGTTCAAGGGATTCTCCTGG - Intergenic
1047113185 8:121813633-121813655 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1047144173 8:122178264-122178286 CCGGGTTCAAACCATTCTCCTGG + Intergenic
1048310470 8:133318720-133318742 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1048933361 8:139335303-139335325 CCGGCTTCAGAGCACTTTCCTGG - Intergenic
1049031367 8:140040486-140040508 CCAGGTTCACGCCATTCTCCTGG + Intronic
1049086899 8:140485821-140485843 CCGGGTTCATGCCATTCTCCTGG - Intergenic
1049315091 8:141961734-141961756 CTGGGTTCACACCATTCTCCTGG + Intergenic
1049769061 8:144371220-144371242 CCGGGTTCAAGTAATTCTCCTGG + Intergenic
1050007892 9:1152951-1152973 CCGGGTTCAGGCGATTCTCCTGG - Intergenic
1050079415 9:1900205-1900227 CCAGGTTCACACCATTCTACTGG - Intergenic
1050210991 9:3256058-3256080 CCGGGTTCACGCCATTCTCCTGG + Intronic
1051247734 9:15128610-15128632 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1052064488 9:24000191-24000213 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1052804364 9:32999864-32999886 CCGGGTTCACGCCATTCTCCTGG - Intronic
1052929735 9:34046548-34046570 CCGGGTTCACGCCATTCTCCTGG - Intronic
1052940516 9:34128509-34128531 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1053573369 9:39332776-39332798 CCGGATTCACACCATTCTTCTGG + Intergenic
1054094935 9:60891483-60891505 CCGGATTCACACCTTTCTTCTGG + Intergenic
1054116404 9:61167383-61167405 CCGGATTCACACCATTCTTCTGG + Intergenic
1054123775 9:61286235-61286257 CCGGATTCACACCATTCTTCTGG - Intergenic
1054591354 9:67015163-67015185 CCGGATTCACACCATTCTTCTGG - Intergenic
1055089839 9:72352217-72352239 CCGGGTTCACGCCATTCTCCTGG - Exonic
1055095881 9:72413896-72413918 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1055328995 9:75162480-75162502 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1056030977 9:82552922-82552944 CTGGGTTCATAGCCTTTTCCTGG - Intergenic
1056059459 9:82869284-82869306 CCAGGTTCATGCCATTCTCCTGG - Intergenic
1056618279 9:88187469-88187491 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1056620325 9:88207033-88207055 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1056643950 9:88393939-88393961 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1056943206 9:90972733-90972755 CCGGGTTCACGCCGTTCTCCTGG - Intergenic
1057098305 9:92332712-92332734 CCGGGTTCAAATGATTCTCCTGG - Intronic
1058043619 9:100332725-100332747 CCGGGTTCACGCTATTCTCCTGG - Intronic
1058463279 9:105203555-105203577 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1058586157 9:106508120-106508142 CTGGGTTCACGCCATTCTCCTGG + Intergenic
1058749328 9:108023562-108023584 CCAGATTCACGCCATTCTCCTGG - Intergenic
1059076496 9:111198716-111198738 CTGGGTTCACACCATTCTCTTGG + Intergenic
1059153024 9:111966282-111966304 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1059936531 9:119316995-119317017 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1060120791 9:120987542-120987564 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1060310218 9:122452932-122452954 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1060390440 9:123272160-123272182 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1060800666 9:126543454-126543476 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1061026090 9:128050739-128050761 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1061123587 9:128659399-128659421 CCAGGTTCATGCCATTCTCCTGG - Intergenic
1061126386 9:128678973-128678995 CCAGGTTCACGCCATTCTCCTGG - Intergenic
1061265802 9:129504328-129504350 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1061292546 9:129659723-129659745 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1061407650 9:130401415-130401437 CCAGGTTCAAGGGATTCTCCTGG + Intronic
1061514354 9:131080064-131080086 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1061742361 9:132716525-132716547 CTGGGTCCACAGCCTTCACCAGG - Intergenic
1061797460 9:133095758-133095780 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1061976223 9:134069086-134069108 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1062061696 9:134500282-134500304 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1062623356 9:137432484-137432506 CTGGGTTCACGCCATTCTCCTGG - Intronic
1203731536 Un_GL000216v2:95946-95968 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1186861348 X:13675313-13675335 CCGGGTTCAAGCCATTCTCCGGG - Intronic
1186866169 X:13722999-13723021 CCGGGTTCACACCATTCTTCTGG - Intronic
1187201758 X:17140862-17140884 CTGGGTTCACACCATTCTTCTGG + Intronic
1187351543 X:18522887-18522909 CCAGGTTCAAGCCATTCTCCTGG + Intronic
1187396415 X:18923333-18923355 CCTGGTCCACAGCATTCTCTTGG + Intronic
1187423625 X:19158243-19158265 CCGGGTTCACTCCATTCTCCTGG - Intergenic
1187470585 X:19566016-19566038 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1187890507 X:23930101-23930123 CTGGGTTCACGCCATTCTCCTGG - Intronic
1187929474 X:24280789-24280811 CCAGGTTCAAGCCATTCTCCTGG - Intergenic
1188357367 X:29208615-29208637 CTGGGTTCACGCCATTCTCCTGG - Intronic
1188466406 X:30486619-30486641 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1188538402 X:31222100-31222122 CCGGGTTCACGCCATTCTCCTGG - Intronic
1188651577 X:32636902-32636924 CCGGGTTCACGCCATTCTCCTGG - Intronic
1188825324 X:34825121-34825143 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1189227144 X:39422330-39422352 CCGGGTTCAAGCCATTCCCCTGG - Intergenic
1189323674 X:40100603-40100625 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1189405356 X:40717614-40717636 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1189433542 X:40970835-40970857 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1189736901 X:44080662-44080684 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1189757150 X:44283274-44283296 CCAGGTTCACGCCATTCTCCTGG + Intronic
1190219531 X:48502318-48502340 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1190238817 X:48640350-48640372 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1191007336 X:55723648-55723670 CCTGGTTCAAGGGATTCTCCTGG + Intronic
1192271293 X:69582097-69582119 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1192311781 X:70022428-70022450 CCAGGTTCACGCCATTCTCCTGG + Intronic
1193431580 X:81412868-81412890 CCAGGTTCACGGGATTCTCTTGG + Intergenic
1193632497 X:83907692-83907714 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1193776295 X:85646400-85646422 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1194480413 X:94415056-94415078 CCTGGCTCACTGCAGTCTCCTGG + Intergenic
1194664593 X:96663476-96663498 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1194840402 X:98733688-98733710 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1194926093 X:99826014-99826036 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1195018098 X:100798242-100798264 ATGTGGTCACAGCATTCTCCAGG - Intergenic
1195480737 X:105341835-105341857 CCAGGTTCATGCCATTCTCCTGG - Intronic
1195686625 X:107592870-107592892 CCGTGTTCAAGCCATTCTCCTGG + Intronic
1195977319 X:110541878-110541900 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1196386555 X:115160220-115160242 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1196794189 X:119489217-119489239 CCGGGTTCAAGCCATTCTCTCGG - Intergenic
1196829758 X:119766776-119766798 CCGGGTTCAAGCGATTCTCCCGG + Intergenic
1197197389 X:123716633-123716655 CCGGGTTCACGCCATTCTCCTGG - Intronic
1197204627 X:123779142-123779164 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1197747985 X:129945773-129945795 CCGGGTTCAAGCCATCCTCCTGG + Intergenic
1197808674 X:130421983-130422005 CTGGGTTCAAGGGATTCTCCTGG + Intergenic
1197990026 X:132308055-132308077 CCGGGTTCACGCCATTCTCCTGG - Intergenic
1198111281 X:133504684-133504706 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1198454442 X:136802111-136802133 CCAGGTTCACGCGATTCTCCTGG + Intergenic
1199284731 X:146043323-146043345 CCGGGTTCACGCCATTCTCCTGG + Intergenic
1199828991 X:151530234-151530256 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1199883909 X:151999844-151999866 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1199943843 X:152650069-152650091 CCAGGTTCACAACACTCTGCAGG + Intronic
1201327176 Y:12774371-12774393 CCAGGTTCACATCATTCTCCTGG - Intronic
1201577905 Y:15479698-15479720 CCTGGCTCACAGGATTATCCAGG - Intergenic