ID: 968315309

View in Genome Browser
Species Human (GRCh38)
Location 3:197719149-197719171
Sequence CATTCTGTACTGATCTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968315307_968315309 29 Left 968315307 3:197719097-197719119 CCTGAGAATCAGTCTGACTCATG 0: 1
1: 0
2: 1
3: 12
4: 160
Right 968315309 3:197719149-197719171 CATTCTGTACTGATCTTACAAGG 0: 1
1: 0
2: 2
3: 3
4: 154
968315308_968315309 -9 Left 968315308 3:197719135-197719157 CCTGTGTTCTGATTCATTCTGTA 0: 1
1: 0
2: 1
3: 29
4: 252
Right 968315309 3:197719149-197719171 CATTCTGTACTGATCTTACAAGG 0: 1
1: 0
2: 2
3: 3
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968315309 Original CRISPR CATTCTGTACTGATCTTACA AGG Intronic
900038937 1:440978-441000 CATTCTGCATTGATCTCACTGGG - Intergenic
900060369 1:675954-675976 CATTCTGCATTGATCTCACTGGG - Intergenic
906586651 1:46984453-46984475 CATTCTGCATTGATCTCCCAGGG - Intergenic
907953437 1:59206226-59206248 CCTTCTGCACTGATCTTGCTGGG - Intergenic
908033621 1:60028616-60028638 CAGTGTGCACTGATCTTTCAAGG - Intronic
910549374 1:88458421-88458443 CATTCTTTACTGTACTTTCATGG - Intergenic
911843765 1:102721220-102721242 CATTGTGTACTGATATGACAAGG - Intergenic
915771874 1:158433441-158433463 CCTTCTGTGCTGATCTCACTGGG + Intergenic
917854818 1:179091656-179091678 CATTCTGTAAGGTGCTTACATGG - Intronic
918941797 1:191009428-191009450 CATTTTGTACTGAACAGACAGGG - Intergenic
919552676 1:199011474-199011496 CACTCTGAATTTATCTTACAAGG - Intergenic
919596746 1:199573525-199573547 CATCCTGTAGTGTTGTTACAAGG - Intergenic
921786313 1:219234135-219234157 CATTCTCAAATGATCTTATAAGG - Intergenic
1064044483 10:11999681-11999703 CATCCTGTCCTGTTCATACATGG - Intronic
1065871481 10:29959922-29959944 CCTTTTGTATTGATCTTCCAGGG - Intergenic
1066164578 10:32772644-32772666 CATTCCTTACTGATCTTAACAGG - Intronic
1069651027 10:70048816-70048838 CAGTCATTACTCATCTTACAAGG + Intergenic
1074988733 10:118682633-118682655 TATTCTGTACTGACCAAACAAGG - Exonic
1076965144 11:76889-76911 CATTCTGCATTGATCTCACTGGG - Intergenic
1078343990 11:10527055-10527077 ATTTCTGTACTGACCTTATATGG - Intronic
1078886990 11:15510427-15510449 CATTATGTACTAAACTTAAAAGG - Intergenic
1079893535 11:26089783-26089805 CAATCTGTACTTAAGTTACACGG + Intergenic
1080304809 11:30824916-30824938 CATTCTTTAATTTTCTTACAAGG - Intergenic
1082069587 11:47928175-47928197 GATTCTGGACTGATCATTCAAGG - Intergenic
1083355954 11:62066292-62066314 GATTCTGTCTTCATCTTACATGG + Intergenic
1088636315 11:111823946-111823968 CCTTATGTACTGATTTCACAAGG - Intronic
1089470441 11:118716237-118716259 AATTCTGTATTCATCTCACATGG - Intergenic
1091455582 12:604954-604976 CTTCCTGTACTTATCTTACTGGG - Intronic
1093608180 12:21119837-21119859 CCTTCTGCACTGATCTCACTGGG + Intronic
1093664577 12:21795948-21795970 CCTTCTGTATTGATCTTGCTGGG + Intergenic
1094276973 12:28688736-28688758 CTCTCTGTCCTGATTTTACATGG - Intergenic
1097074685 12:56384140-56384162 CATTCTTCACTGTTCTTAGAAGG - Intergenic
1099676343 12:85765534-85765556 CATTCTGTAGTGTTCTTTGAGGG - Intergenic
1100200338 12:92291619-92291641 TATTCTTTTCTGTTCTTACAGGG - Intergenic
1100706987 12:97211601-97211623 CTTTCTGTTCTGATCTAAGAAGG - Intergenic
1100713527 12:97282364-97282386 CATTCTGCCATGATCTAACATGG - Intergenic
1100896166 12:99185490-99185512 CCTTCTGCATTGATCTTACTGGG - Intronic
1103813027 12:123631094-123631116 GATTCTGTACAGATGCTACAGGG - Intronic
1104444439 12:128822487-128822509 CCTTCTGGTCTGAACTTACAGGG + Intronic
1105842984 13:24271802-24271824 CAAACTGTACTGCTCTGACAGGG - Intronic
1111007772 13:82271859-82271881 CTTTCTGTACTTATCTTCCTAGG + Intergenic
1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG + Intergenic
1112393211 13:99003819-99003841 CATACTGTACTTATCCTGCAGGG - Intronic
1112650338 13:101389756-101389778 TATTCTGTAATGTTTTTACAAGG - Intronic
1116460971 14:45173323-45173345 CATTCTTTACTGAGATCACAAGG - Intronic
1119389773 14:74283184-74283206 CATTCTGTAATAGTCTTCCATGG + Intergenic
1121872389 14:97420003-97420025 TATTCTGTACTGATTGAACATGG + Intergenic
1122738335 14:103856411-103856433 CACACTGTACTGGTCTTTCAGGG + Intergenic
1126105350 15:45143524-45143546 GACCCTGTAGTGATCTTACAGGG + Intronic
1132442983 15:101886629-101886651 CATTCTGCATTGATCTCACTGGG + Intergenic
1140182933 16:72738161-72738183 CACTTTGTACTGCTCTGACATGG + Intergenic
1145016157 17:19399726-19399748 CTTTCTGCACTGACCCTACATGG + Intergenic
1148653929 17:49269278-49269300 GCGTCTGTACTCATCTTACAGGG + Intergenic
1148905053 17:50906733-50906755 TATTCTGTACTGGTCTTTGATGG - Intergenic
1150675460 17:67243178-67243200 CATTATGTCCTGATCACACACGG - Intronic
1158163701 18:54515207-54515229 TATTCTGTACTATTCTTAAAAGG - Intergenic
1160641949 19:146519-146541 CATTCTGCATTGATCTCACTGGG - Intergenic
1164152447 19:22566548-22566570 CCTTCTGCACTGATCTCACTGGG + Intergenic
1167205986 19:48102628-48102650 CAAACTGTGCTGATCTCACAGGG - Intronic
929756010 2:44765563-44765585 CATTCTGTACACATCTGAGAGGG + Intronic
932965552 2:76470895-76470917 CATTCTTTACTGAAATTTCAAGG - Intergenic
935170438 2:100607389-100607411 CATTCTGTGCTGAACTTCCTGGG - Intergenic
935329111 2:101963307-101963329 CATGCTGCACTGACCCTACAAGG + Intergenic
935961387 2:108429190-108429212 CCTTCTGCACTGATCTTGCTGGG - Intergenic
936640380 2:114304699-114304721 CCTTCTGCACTGATCTTGCTGGG + Intergenic
937000076 2:118457677-118457699 CCTTCTGTATTGATCTTGCTGGG + Intergenic
937112543 2:119377669-119377691 CATTCTGAACTTCTCTTCCATGG - Intergenic
937169844 2:119855064-119855086 TATTAAGTACTGATCTTTCAAGG + Intronic
938087951 2:128413745-128413767 CTTTCTGCACTGATCCCACAAGG - Intergenic
939140587 2:138349792-138349814 CATTCTGTTCTGGTATTTCAAGG - Intergenic
939208527 2:139140582-139140604 CACACTGTTCAGATCTTACAAGG - Intergenic
939266262 2:139877571-139877593 CATTCTGCACTGTTTTTAGAGGG - Intergenic
940063199 2:149595889-149595911 CATTATGTCCTGATGTTACTGGG + Intergenic
940076147 2:149744121-149744143 CATCCTGAACTGAACTGACAAGG + Intergenic
943283231 2:185964319-185964341 TATTAAGTACTGATCTTTCAAGG + Intergenic
944714334 2:202363613-202363635 GAATATGTACTTATCTTACATGG + Intergenic
1173741332 20:45404753-45404775 CATGCTGTATTTATCTCACAGGG + Intronic
1174410785 20:50333745-50333767 CATCCTGTAATAATGTTACAAGG + Intergenic
1177618095 21:23551207-23551229 CATTCTGTACCTATACTACATGG + Intergenic
1183567892 22:38629588-38629610 CATTCTTGCCTGAGCTTACATGG + Intronic
950308771 3:11937584-11937606 CATTCTCTACTGATCACATAGGG - Intergenic
954184739 3:48908162-48908184 CATTTTGTACATATCTTTCAGGG + Intergenic
960583143 3:119297371-119297393 CATTCTGGGCTGATCTTCCAAGG - Intronic
962067822 3:132001344-132001366 CATTATGTACTCATCATACTTGG - Intronic
963481533 3:145880076-145880098 CCTTCTGCACTGATCTTGCTGGG + Intergenic
965017322 3:163174441-163174463 CCTTCTGCATTGATCTTACTGGG - Intergenic
966072887 3:175900869-175900891 CTTTCTGTTCTGATCTGATATGG + Intergenic
966401922 3:179556432-179556454 AATTCTGTGCTGATGTTAAAAGG + Intergenic
967391091 3:188955201-188955223 CATTCTTTACTTAGCTTTCAAGG + Intronic
968315309 3:197719149-197719171 CATTCTGTACTGATCTTACAAGG + Intronic
969609908 4:8221220-8221242 CAACATGTACTGAACTTACAAGG + Intronic
970704826 4:18787920-18787942 CATTCTGTACTCATTTCACTAGG + Intergenic
973018510 4:45171172-45171194 CCTTCAGTACTGCTCTTTCAGGG + Intergenic
975303307 4:72817590-72817612 AAATATGTACTGATTTTACAGGG + Intergenic
980787619 4:137575131-137575153 CATTTTGTACTGAGGTTGCAGGG - Intergenic
981481582 4:145243892-145243914 CCTTCTGTATTGATCTCACTGGG + Intergenic
981795050 4:148585992-148586014 CCTTCTGCATTGATCTTACTGGG + Intergenic
982028533 4:151276502-151276524 CTTTCTGTACTGAGCTAAGAAGG - Intronic
983413087 4:167423144-167423166 TATTAAGTACTGATCTTTCAAGG - Intergenic
984428443 4:179617777-179617799 TATTCTGTACTTATCTCATAGGG - Intergenic
984618534 4:181926758-181926780 CCTTCTGTATTGATCTTCCTGGG - Intergenic
986647036 5:9927499-9927521 CCTTCTGTAATGATCATGCATGG + Intergenic
988615611 5:32771755-32771777 CATTCTGTTCTTATTGTACAAGG - Intronic
989258067 5:39387744-39387766 AATACTGTTCTGTTCTTACAGGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999821544 5:155233799-155233821 CACTCTGAACTGATCTGAAAAGG - Intergenic
1000145529 5:158449760-158449782 CATTGTGTACTGATCAGCCATGG + Intergenic
1002734910 5:181377965-181377987 CATTCTGCATTGATCTCACTGGG + Intergenic
1002749616 6:96157-96179 CATTCTGCATTGATCTCACTGGG - Intergenic
1004837778 6:19547603-19547625 TAATCTGTAATGATCGTACATGG + Intergenic
1007156430 6:39749568-39749590 CATTCTGTGCTAATCCTAGAGGG + Intergenic
1008785007 6:55158053-55158075 CCTTCTGCACTGATCTCACTGGG - Intronic
1009683601 6:66928336-66928358 TATTAAGTACTGATCTTTCAAGG - Intergenic
1011560975 6:88615196-88615218 AATTCTGTCCTCATCTTTCATGG + Intronic
1011897983 6:92256073-92256095 CATTTTGTGCTGTTGTTACAAGG - Intergenic
1014371466 6:120613887-120613909 CAGCCTCGACTGATCTTACATGG - Intergenic
1015140586 6:129927210-129927232 CATTGTGTGGTGATGTTACAGGG - Intergenic
1016593069 6:145767040-145767062 CCTTCTGCACTGATCTCACTGGG + Intergenic
1019239172 6:170650282-170650304 CATTCTGCATTGATCTCACTGGG + Intergenic
1022244852 7:28549332-28549354 GATGCTGTACTGAACTCACAGGG - Intronic
1022895061 7:34741602-34741624 CACTTTGTACTGATCCTTCAGGG + Intronic
1024128146 7:46322010-46322032 CATTCTTAACTGATCTTTCTAGG - Intergenic
1026885633 7:73942190-73942212 CATTCTGAGCTGATCTTACAGGG + Intergenic
1028795236 7:94894916-94894938 TATTTGGTAATGATCTTACATGG + Intergenic
1031613871 7:123857577-123857599 CATTCTGCATTGATCTCACTGGG + Intronic
1035508600 8:156326-156348 CATTCTGCATTGATCTCACTGGG - Intergenic
1040473953 8:47760518-47760540 CCTTCTGTGTTGATCTTACTGGG + Intergenic
1041584060 8:59495487-59495509 CATTCTGCATTGATCTCACTGGG + Intergenic
1041826515 8:62101152-62101174 TATTAAGTACTGATCTTTCAAGG + Intergenic
1042670732 8:71260695-71260717 CTCTCTGTACTAATCCTACATGG + Intronic
1045397767 8:101778058-101778080 CTTTCTGTACAAATCTTAAAGGG - Intronic
1045613659 8:103879135-103879157 CACTCTCTACTGATCTTTCTAGG - Intronic
1045783582 8:105896718-105896740 CATTCTGCGTTGATCTTACTGGG - Intergenic
1046247891 8:111590653-111590675 CATCCTGGTTTGATCTTACAGGG - Intergenic
1048541029 8:135342256-135342278 CCTTGTGTATTGATCTGACAAGG - Intergenic
1050196266 9:3087359-3087381 TATTAAGTACTGATCTTTCAAGG - Intergenic
1052625768 9:30975016-30975038 CATGCTGTACTTCTCATACATGG - Intergenic
1053390249 9:37729789-37729811 GATGCTGTACTGCTCTTCCAGGG - Exonic
1055031543 9:71775119-71775141 CATTCTGTAATGTTATTGCAAGG - Intronic
1056000884 9:82215640-82215662 CATTCTGCACTGATCTCACTGGG - Intergenic
1056702271 9:88920682-88920704 CATTTTGGACTGTTCTAACATGG - Intergenic
1058072983 9:100619996-100620018 CCTTCTGTGTTGATCTCACAGGG + Intergenic
1062759378 9:138330573-138330595 CATTCTGCATTGATCTCACTGGG + Intergenic
1203599827 Un_KI270748v1:1345-1367 CATTCTGCATTGATCTCACTGGG + Intergenic
1187240977 X:17512900-17512922 CAGTCTCTACTGAACTTACTTGG - Intronic
1188809289 X:34633005-34633027 AAATCTGTACTGATCCTACCAGG + Intronic
1190549676 X:51566162-51566184 CATTCTGTGCTTTTTTTACAGGG - Intergenic
1191206627 X:57841824-57841846 CATTCTGCATTGATCTCACTGGG - Intergenic
1192129085 X:68530861-68530883 CCTTCTGTATTGATCTTGCTGGG + Intronic
1192992029 X:76470973-76470995 CCTTCTGCACTGATCTTCCTGGG - Intergenic
1193081690 X:77412435-77412457 CCTTCTGCACTGATCTCACTGGG + Intergenic
1193361786 X:80587274-80587296 CCTTCTGTACTGATCTTACTGGG + Intergenic
1194355683 X:92881712-92881734 CCTTCTGCATTGATCTTACTGGG - Intergenic
1194515431 X:94845585-94845607 CCTTCTGCACTGATCTTGCTGGG + Intergenic
1197078738 X:122386211-122386233 CATGATGTAATGATCTTAGAAGG + Intergenic
1198626130 X:138577541-138577563 CAGTCTGTTCTGTTCTAACAGGG + Intergenic
1199119557 X:144035509-144035531 CATTCTGATAAGATCTTACATGG + Intergenic
1199418101 X:147610109-147610131 CATTCTATAATGATCAAACAGGG + Intergenic
1200664029 Y:5998694-5998716 CCTTCTGCATTGATCTTACTGGG - Intergenic
1201676251 Y:16588097-16588119 CATTATGGAATGATCTTAAATGG + Intergenic