ID: 968315426

View in Genome Browser
Species Human (GRCh38)
Location 3:197720293-197720315
Sequence CCTGGAGGATGTTACCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968315426_968315433 11 Left 968315426 3:197720293-197720315 CCCTTAAGGTAACATCCTCCAGG 0: 1
1: 0
2: 1
3: 8
4: 147
Right 968315433 3:197720327-197720349 TGCCAAAACTGAAAGAATTAAGG 0: 1
1: 0
2: 3
3: 22
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968315426 Original CRISPR CCTGGAGGATGTTACCTTAA GGG (reversed) Intronic
901849208 1:12004756-12004778 CCTGGTGGATGTGGCCTGAAGGG + Intronic
903737840 1:25541646-25541668 CCTGGAGGAGGCAACTTTAAAGG + Intergenic
904365264 1:30006999-30007021 CCTGGTGGATTTTTCCTTAGGGG + Intergenic
908371184 1:63479723-63479745 CCTGGAGAATATTATGTTAAGGG - Intronic
911576887 1:99588623-99588645 CCAGAAAGATGTTACCGTAAAGG + Intergenic
915070945 1:153266354-153266376 GCTGGAGGATATTATGTTAAGGG - Intergenic
919452783 1:197790131-197790153 CCTGGAGCATATTATGTTAAAGG - Intergenic
923642573 1:235779636-235779658 CCTAAAGGATGTTTTCTTAATGG + Intronic
924592946 1:245420907-245420929 CCTGGATGATGGGACCCTAAAGG + Intronic
1064610241 10:17092049-17092071 CCAGGAAGATGTTACCAGAAAGG - Intronic
1065905810 10:30250059-30250081 CCTGTAGGATCCAACCTTAAGGG + Intergenic
1067260570 10:44686587-44686609 CATAGAGGATGTTGCCTTAGAGG - Intergenic
1069321236 10:67173976-67173998 CCAAGAGGATGTAACCTTTAGGG + Intronic
1069936350 10:71919966-71919988 CCTGAAAGATGTTACCAGAAAGG + Intergenic
1070603876 10:77884822-77884844 CCTGGACGGTGTTACTTTATCGG - Intronic
1071585775 10:86819757-86819779 CCTGGAGACTGTTACCCTACCGG - Intronic
1072268175 10:93750662-93750684 ACTGGAGGACGTTATGTTAACGG - Intergenic
1073466772 10:103698851-103698873 CCTGGAGGAGGAGGCCTTAAAGG + Intronic
1076211384 10:128648346-128648368 CCTAGAGGACATTACCCTAAGGG - Intergenic
1076508622 10:130996544-130996566 CCTGATGCATGTTACCTTAGCGG + Intergenic
1077156352 11:1093617-1093639 CCTGCAGGATGCTTCCTTCAGGG + Intergenic
1077702607 11:4455863-4455885 CCTAGAGGAACTTCCCTTAAGGG - Intergenic
1079235138 11:18682973-18682995 CCAGGAAGATGTTACCAGAAAGG - Intergenic
1080306874 11:30845829-30845851 CATGTAGGATGTTACTTTGAAGG + Intronic
1080729899 11:34938863-34938885 CCTGGAGCATGTTTCCCTGAAGG + Intronic
1082760814 11:57125131-57125153 TCTGGAGGTTGTTGCCTTCAAGG + Intergenic
1090343479 11:126046851-126046873 CCTTGAGGATGGTACTTTACTGG + Intronic
1090705488 11:129332672-129332694 CCTGGAGAATTTTGCCTTCATGG - Intergenic
1090718952 11:129455322-129455344 CCTGGAGGACATTATGTTAAGGG - Intergenic
1100782020 12:98037419-98037441 CATGGAGGAGGATACCTTAGTGG - Intergenic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1101776022 12:107794600-107794622 CCTGGGGGATGTGACATTAAAGG + Intergenic
1101787222 12:107894710-107894732 ACTGGAGGACATTATCTTAAGGG - Intergenic
1102495470 12:113316272-113316294 CTGGGAGTATGTTACCTTTATGG - Intronic
1104123449 12:125820903-125820925 CCTTGAGAATTTTAACTTAAAGG + Intergenic
1105284369 13:18992648-18992670 CATGGATGATGTAACTTTAAAGG + Intergenic
1107311238 13:39081264-39081286 CCAGGAAGATGTTACCAGAAAGG - Intergenic
1107592786 13:41925955-41925977 CCTGAATGATGTCACCTTAAAGG + Intronic
1109848094 13:68023979-68024001 GCTGGAGCATGTCAGCTTAATGG + Intergenic
1110321440 13:74164769-74164791 ACTGGAGGATATTATGTTAAGGG + Intergenic
1111634390 13:90884526-90884548 CATGGAGGATGTTCACTAAAGGG + Intergenic
1113937919 13:114004982-114005004 ACTAGAGGTTGTTATCTTAAGGG + Intronic
1114769449 14:25411776-25411798 CCTGGAGGTTGTAACCCAAAAGG + Intergenic
1115486395 14:33915040-33915062 CCTGGTGGATGATGCCTGAAAGG + Intergenic
1116274221 14:42810336-42810358 CCTTAAGGATGTGACTTTAATGG + Intergenic
1116392268 14:44407257-44407279 CCTGGTGGCTATTACCCTAAGGG + Intergenic
1117359300 14:54957577-54957599 CTTGGAAGAGTTTACCTTAAAGG + Exonic
1118364146 14:65079866-65079888 CCTTGAGGAAATTACCTTAAGGG - Intronic
1119906980 14:78314524-78314546 CTTGGAGGATTTTTCCTAAAGGG + Intronic
1122592196 14:102861621-102861643 CCAGGAAGATGTTACCGGAAAGG + Intronic
1126726482 15:51637173-51637195 CCAGGAAGATGTTACCGGAAAGG + Intergenic
1127668102 15:61169030-61169052 CCTGCTGGATCTCACCTTAAAGG + Intronic
1127690809 15:61395066-61395088 CCTGGAGAATGTTCCCTTCTTGG + Intergenic
1129329620 15:74820402-74820424 CCTGGAGGAGATGAGCTTAAAGG + Intronic
1139369422 16:66457565-66457587 TCTGTAGGATGTCACCTTGATGG - Intronic
1140348065 16:74234105-74234127 CCTGGAGTCTTTTACCTTAGGGG - Intergenic
1141198377 16:81878548-81878570 CTTGGAGTAGGTTACTTTAAAGG - Intronic
1141490614 16:84370143-84370165 CATGGATGATGTAACCTCAAGGG + Intronic
1142129230 16:88425214-88425236 CCTGGAGGAGGTGGCCTTTACGG - Intergenic
1144555505 17:16279149-16279171 CCTGGAAGATGTTACCGGGAAGG + Intronic
1147021289 17:37535850-37535872 ACTGGAGCATGTTATATTAAAGG - Intronic
1147191097 17:38738648-38738670 CCAGGAGGATGATCCCTCAATGG + Intronic
1147357852 17:39911582-39911604 CTTGGAGGATGTTTCCTGCATGG - Intronic
1148613151 17:48978418-48978440 CCAGGAAGATGTTACCGGAAAGG - Intergenic
1151499082 17:74477501-74477523 CCTGGAGGATGTTTCAGAAATGG + Exonic
1153784269 18:8520508-8520530 CTTTTAGGATGTTCCCTTAAAGG + Intergenic
1159075335 18:63674865-63674887 CCTGGAGAAAGTTATGTTAAAGG - Intronic
1163483505 19:17572831-17572853 CCTGGAGGAGGTGGCATTAAGGG + Intronic
1163559451 19:18010174-18010196 CCTGGAGGAAGGAACCATAAGGG - Exonic
925843629 2:8016283-8016305 CCTGGAGGATTTCAACATAAAGG - Intergenic
925918027 2:8621068-8621090 CCAGGAAGATGTTACCGGAAAGG + Intergenic
933400195 2:81786405-81786427 CCAGGAGGATTTTGACTTAACGG + Intergenic
933528092 2:83469229-83469251 CCTGGAGTATGTTAGCATGAGGG + Intergenic
935320653 2:101885280-101885302 ACTTGATGTTGTTACCTTAAAGG - Exonic
937760625 2:125598249-125598271 CCTGGAGGCTATTATCTTAAGGG - Intergenic
944136568 2:196406106-196406128 GCTGGAGGAGGTTACCCTGAAGG - Intronic
945017924 2:205539440-205539462 TCTAGAGGATGATACCTAAAAGG - Intronic
947022194 2:225691803-225691825 CCTGGAGAAACTTCCCTTAAAGG + Intergenic
947706910 2:232283708-232283730 TTTTGAGGATGTTACCTAAATGG - Intronic
947923283 2:233898212-233898234 CTTGCAGGATTTTACCTTAGGGG + Intergenic
1168746120 20:242711-242733 CCTGGAAGATTTTACCATACTGG + Intergenic
1168756841 20:324433-324455 CCTGGGGGAGGTCACCTTCACGG - Intergenic
1170513390 20:17102700-17102722 CCTGGAGGAGGTGAGCTTACGGG - Intergenic
1171950815 20:31420122-31420144 CGTGGAGGATATTATCTTAAGGG + Intergenic
1172933665 20:38603221-38603243 CCTAGAAGTTGTTCCCTTAAGGG - Intronic
1173752621 20:45488816-45488838 CCAGGAAGATGTTACCAGAAAGG + Intergenic
1174243281 20:49155954-49155976 CCTGGAGGCTGTGTCATTAATGG - Intronic
1174334569 20:49849785-49849807 CCAGAAGGAATTTACCTTAAGGG - Intronic
1174534773 20:51242742-51242764 CCTGGAGGATGACACCCTAGAGG - Intergenic
1175471689 20:59234542-59234564 CCTCTAGGATGTTACCGTCAGGG - Intronic
1175948203 20:62568476-62568498 CCTGGAGCATCTTGCCTTAGGGG + Intronic
1179478454 21:41662836-41662858 CCTGGAGGATGCCAGCTTCAGGG - Intergenic
1179543669 21:42100636-42100658 CCTGGAGGATGGTTCTGTAATGG - Intronic
1180075895 21:45461758-45461780 CCTGGAGGATATTAAACTAAAGG - Intronic
1182245744 22:28956124-28956146 CCTGGCAGATGTCACCTTCAAGG + Intronic
1184730548 22:46368953-46368975 GCTGGAGGAGGTTAGCTGAAGGG - Intronic
954198834 3:49012386-49012408 CCTGGAGGATCTCACCTTCATGG - Exonic
958119600 3:89267589-89267611 CATGGAGGAAGCTACATTAAAGG + Intronic
959218896 3:103489668-103489690 CATGAAGGATATTACCTTGATGG - Intergenic
961157231 3:124690463-124690485 GCTGGAGGATTTTAAATTAAAGG + Intronic
964939813 3:162144025-162144047 CCTGTAATATGTTACCTTATTGG - Intergenic
965754849 3:172015230-172015252 CCTGGAGGGTGGTACCTGCAGGG + Intergenic
965791152 3:172389014-172389036 GCAGAAGGATGTTACCTTCAAGG + Intronic
968315426 3:197720293-197720315 CCTGGAGGATGTTACCTTAAGGG - Intronic
974061197 4:57037731-57037753 CCTGGGGCATGTGACCTTATTGG - Intronic
979496717 4:121392292-121392314 CCTGCAGAATGTTTCCTGAATGG + Intergenic
980737563 4:136911140-136911162 CCTGGAGGACATTATGTTAAAGG - Intergenic
980886558 4:138768740-138768762 CCTTGAGGATGTTATGCTAAGGG - Intergenic
982376822 4:154700643-154700665 CCTGGAGGATGTTATACTAAGGG + Intronic
986862296 5:11941115-11941137 CCTGGAGGACATTATGTTAAGGG + Intergenic
995417134 5:111924363-111924385 CCTGGATGATGTTGCCACAAAGG - Intronic
996577556 5:124992980-124993002 CCTGGAGAATATTATGTTAAGGG - Intergenic
997219308 5:132146780-132146802 CCTGGAGGACATTATGTTAAGGG + Intergenic
999491887 5:152059251-152059273 ACTGGAGGATGTAGCCTGAATGG + Intergenic
1007884936 6:45216852-45216874 CCTGGAGGATATTATGTTAAGGG + Intronic
1009701634 6:67191229-67191251 CCTGGAGCACTTCACCTTAATGG - Intergenic
1012230631 6:96757119-96757141 CCTGGAGGACATTATGTTAAGGG + Intergenic
1014634371 6:123826639-123826661 CCTTGAAGATATTACATTAAGGG - Intronic
1016863217 6:148742661-148742683 TCTGGAGGATATTATGTTAAAGG - Intergenic
1018148024 6:160911518-160911540 CCTGGAGGATGCTACAGCAATGG - Intergenic
1019596409 7:1860439-1860461 CCTGCAGGATGTCACCTCTAGGG - Intronic
1019885657 7:3902472-3902494 CCTGGAAGATGTCTCATTAAGGG + Intronic
1020564856 7:9782319-9782341 ACTGGAGGATGTTACTATAGTGG - Intergenic
1026792687 7:73345130-73345152 CCTGGAGGATGTTTTATTAGAGG - Intronic
1035309865 7:157960041-157960063 CCTTGAGGATATTATGTTAAGGG + Intronic
1038982521 8:32775449-32775471 GCTGGAGGCTGTTATCCTAAGGG - Intergenic
1039788688 8:40856644-40856666 CCTGGAGCATGTTGTCATAAAGG + Intronic
1041700703 8:60786172-60786194 CCTTGAGGTGGTTACCCTAAAGG - Intronic
1043393616 8:79815114-79815136 CCTGGAGTTTGTTAGCTTGATGG - Intergenic
1046457095 8:114480697-114480719 CCTTGGGGATGTTTACTTAAAGG - Intergenic
1050018696 9:1261878-1261900 CATGGAAAATGTTTCCTTAAAGG + Intergenic
1050516719 9:6452172-6452194 CCTGTATTATGTTATCTTAAGGG + Intronic
1050758495 9:9037416-9037438 CCTGGAGAAGGTCATCTTAATGG - Intronic
1051166974 9:14273299-14273321 ACTGGCCCATGTTACCTTAAAGG - Intronic
1052875990 9:33564325-33564347 TCTGGAGGATATTATGTTAAGGG - Intronic
1054793658 9:69278676-69278698 CCTGGAGGAGGTGACATTTAAGG - Intergenic
1057163601 9:92908707-92908729 CCAGGAAGATGTTACCAGAAAGG + Intergenic
1058015705 9:100030278-100030300 CCAGGAGGATATTACCAGAAAGG - Intronic
1185596231 X:1308611-1308633 CCAGGAGGATGTTACCTATGTGG - Intronic
1187892078 X:23945869-23945891 CATGGAGGGTGTAACCCTAACGG - Intergenic
1187925426 X:24245296-24245318 TCTGGAAGATGTTGCCTTCAGGG - Intergenic
1188126521 X:26375023-26375045 CCAGGAAGATGTTACCAGAAAGG + Intergenic
1189048552 X:37619352-37619374 CCTTGAGGATGTTTCCTGACAGG + Intronic
1190244170 X:48679957-48679979 CCAGGAAGATGTTACCGGAAAGG - Intronic
1190929353 X:54934814-54934836 CCTGCAGGAGGTTCCCTTAGTGG - Intronic
1191219047 X:57965916-57965938 CCAGGAAGATGTTACCAGAAAGG + Intergenic
1192591252 X:72361352-72361374 CCTGGGAAATGTTATCTTAATGG + Intronic
1192592525 X:72372197-72372219 CCTGGAGAATGTTCCCAAAAAGG - Intronic
1195040314 X:101008153-101008175 CCAAGAGGAAGTTACCTTATAGG + Intergenic
1195097229 X:101514762-101514784 CCTGGGGAATGTTTCCATAATGG + Intronic
1196029502 X:111080944-111080966 CCTGGAGGACATTATATTAAAGG + Intronic
1196061326 X:111411042-111411064 CCTGGAGGCTGTCCCTTTAAAGG - Exonic
1196227467 X:113183317-113183339 CCTGGAGGATATTATGGTAAGGG + Intergenic
1197850205 X:130850581-130850603 CAAGGAGGATGCTAACTTAATGG - Intronic
1200354887 X:155538251-155538273 CCTGGAGGAATTTATGTTAAAGG - Intronic
1200359727 X:155592058-155592080 CCTGGAGGATGTTATGTTAAGGG + Intronic
1201549221 Y:15201712-15201734 CCTGGAGGGCATTATCTTAAGGG - Intergenic