ID: 968319667

View in Genome Browser
Species Human (GRCh38)
Location 3:197754231-197754253
Sequence ATGTATCTCAATAAGCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968319667 Original CRISPR ATGTATCTCAATAAGCATAA AGG (reversed) Intronic
901722904 1:11214642-11214664 AGGTATCTTTAAAAGCATAATGG + Intronic
904487567 1:30837380-30837402 ATTTATCTCATTGAGCAGAAGGG + Intergenic
907145468 1:52226895-52226917 ATTTATCTCATTGAGCAGAAGGG + Intronic
907878049 1:58514204-58514226 ATGTATATGAATATGCATTAAGG + Intronic
908738315 1:67299941-67299963 ATGTATGTAAATAAACACAAGGG + Intergenic
908969058 1:69804126-69804148 ATGTATTTCAATAAAAACAACGG - Intronic
908985911 1:70021182-70021204 ATCTATCTGAATAAGAAAAACGG - Intronic
909242156 1:73227597-73227619 ATGTATATCAATCAGCATGATGG + Intergenic
912861652 1:113219008-113219030 ATTTATCTCAGTGAGCATAGGGG - Intergenic
915765930 1:158362491-158362513 ATATAACTCAATGAGTATAAAGG - Intergenic
917153206 1:171966334-171966356 AGGTCTCTCACTAAGCATGAGGG + Intronic
918596220 1:186296472-186296494 ATGTAATTTAATAAGCATCATGG - Intronic
921231544 1:213077908-213077930 AATTATCTCAATAAGTAAAAGGG - Intronic
922030930 1:221797427-221797449 ATGTATCTCTATATGCACAAGGG - Intergenic
922035887 1:221847397-221847419 ATGGGTCTCAATAAGTAGAAAGG - Intergenic
922195724 1:223358916-223358938 ATGTTTCTCAATAAAACTAAGGG + Intronic
1063945520 10:11172461-11172483 CTTTATCTCAATCAGCACAATGG - Intronic
1065446911 10:25812156-25812178 TTGTATCTCATGAAGCATGAAGG + Intergenic
1066706553 10:38185698-38185720 ATGTCTCTCCATAAGAGTAAGGG - Intergenic
1068293892 10:55042026-55042048 TTGTATCTGAATAAGCCTTATGG - Intronic
1068741555 10:60478851-60478873 ATCTACCTTAATAACCATAAGGG + Intronic
1068941752 10:62687573-62687595 ATGTATCTAAATAAGTACACAGG - Intergenic
1069206109 10:65688207-65688229 ATGTATCTCACTAAGAAAGATGG + Intergenic
1070251134 10:74773980-74774002 ATTTATCTCAGTGAGCAGAAGGG + Intergenic
1071050977 10:81449105-81449127 ATGTATATCAACAAGTGTAAAGG - Intergenic
1073811598 10:107158194-107158216 ATGTCTCTCAATGACCATAAAGG + Intronic
1077593015 11:3507462-3507484 ATTTATCTCAGTAAGCAAAGGGG - Intergenic
1077859437 11:6161875-6161897 ATTTATCTCAGTAAGCAGAGGGG + Intergenic
1079064543 11:17277550-17277572 CTGTCTCTCAAAAATCATAATGG - Intronic
1081324807 11:41730920-41730942 ATTTATCTCAGTAAGGAGAAGGG + Intergenic
1086012970 11:82127561-82127583 ATGTATTTTAAAAAACATAAAGG + Intergenic
1086247853 11:84776105-84776127 GTGTACCTCAATAAACAAAAAGG - Intronic
1087047715 11:93857137-93857159 ATTTATCTCAGTAAGCAGAGGGG + Intergenic
1087050198 11:93879114-93879136 ATTTATCTCAGTGAGCAGAAGGG + Intergenic
1088025114 11:105170423-105170445 ATGGATTTTAATAAGAATAATGG - Intergenic
1088073220 11:105815090-105815112 CTATCTCTCAATAAGCAAAAAGG - Intronic
1088124576 11:106408500-106408522 ATTAATCTCAATCAGGATAAGGG - Intergenic
1088618618 11:111659521-111659543 ATGTGTCTCAAGAAGCAGAGAGG - Intronic
1093562250 12:20554973-20554995 ATATATCTTAATAACCAGAAAGG + Intronic
1095135470 12:38596006-38596028 CTGTATTTCAATCAGCAGAAAGG + Intergenic
1095819151 12:46458432-46458454 TTATATCTCAATAATCATTAGGG + Intergenic
1096885342 12:54713578-54713600 AGGCAGCTCAATATGCATAATGG + Intergenic
1097437475 12:59569254-59569276 ACGTATCTTGATAATCATAATGG - Intergenic
1097768630 12:63553950-63553972 ATATAAATCAATAAGAATAAAGG + Intergenic
1102320045 12:111925483-111925505 ATATATGTCCATTAGCATAAGGG - Intergenic
1103850871 12:123932524-123932546 ATGTATATGAATATGCATAGGGG + Intronic
1104298235 12:127538652-127538674 ATTTATCTCAGTAAGCAGAGGGG - Intergenic
1105800334 13:23897361-23897383 TTTTATCACAATATGCATAAAGG + Intronic
1106974008 13:35184300-35184322 ATGTATATTAATATGCATAGTGG + Intronic
1109770631 13:66967186-66967208 ATGTATCTAAATCCTCATAATGG + Intronic
1110958587 13:81590588-81590610 ATGTATATGTATAAGCATTATGG + Intergenic
1111718736 13:91914552-91914574 ATGTATCCCAATAATAACAATGG + Intronic
1112045611 13:95594346-95594368 ATGTATCTATAGAAGCATGATGG + Intronic
1114509999 14:23250939-23250961 ATGTATCTCAGTGAGCAGAAGGG + Intronic
1115427614 14:33278515-33278537 AAGTATCTCAAGAACGATAAGGG + Intronic
1116170976 14:41402035-41402057 CTGCTTCTCAATAAGTATAAAGG + Intergenic
1116250112 14:42470846-42470868 ATCTATCTCCATAAGGATAGGGG - Intergenic
1117296757 14:54387308-54387330 ATGAACCTCATTAACCATAAAGG - Intergenic
1117828389 14:59726918-59726940 CTGTTTCTCAATAAGCAAAAAGG - Exonic
1120466229 14:84861023-84861045 ATCTATCTCAGTGAGCAGAATGG + Intergenic
1120673401 14:87390245-87390267 ATATCTCTCAGTAAGCATAGTGG + Intergenic
1123778442 15:23602931-23602953 TTGGATCTCAATAAGCATTTTGG + Intronic
1123897985 15:24847777-24847799 TTGTAAATCAATTAGCATAATGG - Intronic
1124164496 15:27312467-27312489 ATGTATCTCAGTATGCATTTTGG - Intronic
1124395320 15:29295460-29295482 ATGTATCCCCCTAAGGATAAGGG - Intronic
1126454715 15:48848654-48848676 ATATATGTAAATAAGAATAAGGG + Intronic
1126976711 15:54190625-54190647 ATGTATCACAATATCCATGAGGG + Intronic
1130697281 15:86143373-86143395 ATGTATGTAAATATGCATATGGG - Intronic
1136925277 16:34366481-34366503 TTGTTTCTCAGTAAGAATAAGGG + Intergenic
1136979297 16:35045325-35045347 TTGTTTCTCAGTAAGAATAAGGG - Intergenic
1139259495 16:65578133-65578155 GTGTATCTCCATTATCATAATGG - Intergenic
1140842916 16:78858382-78858404 ATGTATCTGTATATGTATAATGG + Intronic
1141289227 16:82702315-82702337 ATGTATTTCAAGAACCATGATGG - Intronic
1149374274 17:56028469-56028491 ATGTATCTGAACAAGAAGAAAGG + Intergenic
1150585954 17:66517952-66517974 TTCTATTTCAATAAGCAAAAGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153895962 18:9560460-9560482 TTGTATCTCAGGAAGCAAAATGG + Intronic
1155737749 18:29245240-29245262 TTCTATCTCAATAACCATCATGG + Intergenic
1155972651 18:32095913-32095935 AGGTATCTAAATTAGCCTAAAGG + Intronic
1156931658 18:42651790-42651812 ATGTATTTCTCTTAGCATAATGG - Intergenic
1157947941 18:52002209-52002231 ATTTATCTCAATGAGCAGAGGGG - Intergenic
1159471976 18:68868671-68868693 TTGAATATCAATTAGCATAAGGG - Intronic
1160404520 18:78635789-78635811 ATGTATTTCCATGAGAATAAAGG + Intergenic
1160570557 18:79814776-79814798 ATGTATATGTATATGCATAAAGG + Intergenic
1168144801 19:54415139-54415161 AAGTTTCTCCATAAGGATAAAGG + Intergenic
925173335 2:1766218-1766240 ATGTATCTCAGTGAGCAGAGGGG + Intergenic
926649905 2:15331939-15331961 ATATTTCTCAATAAGGATCAGGG + Intronic
926879751 2:17531321-17531343 ATATATCTTAATATTCATAAGGG - Intergenic
931186629 2:59958802-59958824 TTTAAGCTCAATAAGCATAAAGG - Intergenic
933169847 2:79113158-79113180 ATTCATCTCAATTAACATAATGG + Intergenic
933228045 2:79773551-79773573 ATCTATCTCAGTAAGCAGAGGGG + Intronic
935143049 2:100371765-100371787 ATGTATGTTAATATGCTTAATGG - Intergenic
936666975 2:114608165-114608187 TTGTAACTCACTAAGAATAAGGG - Intronic
938553324 2:132400617-132400639 AGGTATCTCCAGAGGCATAATGG + Intergenic
938618674 2:133026814-133026836 GTGTATCTCAATGAGCACAATGG - Intronic
938649752 2:133370536-133370558 ATGAGACTCATTAAGCATAATGG - Intronic
939642354 2:144655852-144655874 AACAATCTCAAGAAGCATAAAGG - Intergenic
940432369 2:153608059-153608081 ATTTTTCTGAATAAGCATCAGGG + Intergenic
940494421 2:154407257-154407279 ATGTATTTCTCTAAGTATAATGG + Intronic
942080856 2:172398353-172398375 ATCTATCTCACTAAGCCAAAGGG - Intergenic
942700359 2:178700807-178700829 ATGTATAACAAAAAGAATAATGG - Intronic
943410351 2:187539144-187539166 ATGGATTTCAATAAACATTAAGG + Intronic
945868753 2:215204462-215204484 ATTTATCTCAGTTAGCAGAAGGG - Intergenic
945869655 2:215213438-215213460 ATTTATCTCAGTAAGCAGAGGGG - Intergenic
947852878 2:233302778-233302800 ATATATCTCAATAAAGATAGAGG + Intergenic
1171161329 20:22926515-22926537 ATGTATCTCAACCAGGATCATGG - Intergenic
1180660017 22:17459074-17459096 GTGTAACTCAATAATCAGAAGGG - Intronic
1183169661 22:36177885-36177907 ATGTAACTCCATAAACACAAAGG + Intergenic
949687944 3:6599630-6599652 ATGTATTTAAATAATGATAATGG + Intergenic
949836659 3:8277608-8277630 ATTTATCTCAGTGAGCAGAAGGG - Intergenic
950900939 3:16496928-16496950 ATGAATCTCAAAAATCAAAAAGG + Intronic
952909342 3:38168803-38168825 ATGAACCTCAAAAAGCATTATGG - Intronic
956503763 3:69914971-69914993 ATGTATTCCACTAAGCACAAGGG + Intronic
957727964 3:84092236-84092258 ATGTTTCTCTAAAAACATAAAGG + Intergenic
958689231 3:97440897-97440919 ATATATATCAATAAATATAAAGG + Intronic
959082036 3:101812458-101812480 AAGTTTCTCAATAAGCGTAGAGG - Intronic
959786752 3:110308406-110308428 GTGTATTACAATAAGCAAAAGGG - Intergenic
959904451 3:111694912-111694934 ATATGTCTCAATATGCATACAGG - Intronic
961346275 3:126265430-126265452 ATCTATCTCAGTGAGCAGAAGGG - Intergenic
961912046 3:130327823-130327845 ATGTTTATAAATAAGCAGAATGG + Intergenic
962032029 3:131611190-131611212 ATTTATATCAATAAGTATAATGG - Intronic
962085164 3:132183561-132183583 ATGTATATTGATAAGCATAATGG - Intronic
963372566 3:144419927-144419949 ATGTATCTCAAAAGGGACAAAGG + Intergenic
963583595 3:147156535-147156557 ATGTCTCTCAATAAAGATGATGG + Intergenic
963595818 3:147322892-147322914 AATTATCTCAAATAGCATAACGG + Intergenic
968043732 3:195611692-195611714 ATCTATCTCAGTAAGCAGAGGGG - Intergenic
968319667 3:197754231-197754253 ATGTATCTCAATAAGCATAAAGG - Intronic
970318562 4:14853257-14853279 ATGTATCTCCCAAAGCATATGGG - Intergenic
970376288 4:15460591-15460613 ATGTATGTCAAAGAGCACAAGGG - Intergenic
971643064 4:29160050-29160072 ATGCATAGCAGTAAGCATAAAGG - Intergenic
971968622 4:33593909-33593931 ATGATTCTCAATAAGCAGAGAGG + Intergenic
973193569 4:47414489-47414511 ATTTATCTCAGTAAGCAGAGGGG + Intronic
973644044 4:52932466-52932488 CTGGACCTCAAAAAGCATAATGG - Intronic
975265299 4:72357716-72357738 ATTTAACTCAATATGCATGATGG + Intronic
975373733 4:73618445-73618467 ATGTCTATCAATAAATATAAAGG + Intronic
975960175 4:79893481-79893503 ATACATCTCAATAATAATAAAGG - Intergenic
976401961 4:84617174-84617196 GGGTATCTCAAGAAACATAATGG + Intronic
976424403 4:84884558-84884580 ATATATCTCAAGGATCATAATGG + Intronic
976459685 4:85295268-85295290 AAGTTTCTCAACAAGCATTAGGG + Intergenic
979061104 4:116061509-116061531 ATGGATGTCAATAAGTATAATGG - Intergenic
980270281 4:130575044-130575066 ATTTATCTCAGTGAGCAGAAGGG + Intergenic
982357246 4:154484400-154484422 ATGTATTTCCATAATAATAAAGG + Intronic
982790444 4:159585833-159585855 ATGTATCTCAATATGCTTACAGG - Intergenic
983338426 4:166425476-166425498 ATGTATTCCAATCAGAATAAAGG + Intergenic
984391898 4:179145675-179145697 ATGTCTATCATTAATCATAAAGG + Intergenic
984491700 4:180441709-180441731 ATGTATCCAAATCAGCATTAGGG + Intergenic
986525479 5:8669639-8669661 GTCGATCTCAATAAGCAGAAAGG - Intergenic
987328284 5:16832350-16832372 ATGTATCTGGATAAATATAAGGG + Intronic
988982069 5:36580871-36580893 ATTCATCTCAGTATGCATAATGG + Intergenic
992292969 5:75299295-75299317 ATTTATCTCAATGAGCAGAGGGG - Intergenic
995617888 5:113986941-113986963 ATGTCATTCAATAAACATAATGG + Intergenic
995780065 5:115765492-115765514 ATGTTTCTCAATGTACATAAAGG + Intergenic
995912234 5:117201821-117201843 ATATATCTGAATATTCATAAGGG + Intergenic
996196576 5:120614167-120614189 ATATATGTCATTGAGCATAAAGG + Intronic
996345182 5:122479806-122479828 ATGTTTCTTAAGAACCATAAAGG + Intergenic
1000278932 5:159765263-159765285 AAGTAGCTTAATAAGCACAAGGG + Intergenic
1001760936 5:174207564-174207586 ATGTATGTCAGATAGCATAATGG + Intronic
1004851858 6:19707445-19707467 ATGTGACTCAATAAGCATGGTGG - Intergenic
1005079812 6:21945440-21945462 ATGTATTTCAATAAACTAAAAGG - Intergenic
1008459332 6:51749942-51749964 ATTTATCTCATTAAAAATAAAGG + Intronic
1010559995 6:77337536-77337558 ATTTATCTCAGTGAGCAAAAGGG - Intergenic
1011500691 6:87986080-87986102 ATGTACCTCAACAAAAATAAAGG + Intergenic
1011813211 6:91156822-91156844 TTGTATCTTAATAACCATCAAGG + Intergenic
1012731097 6:102882401-102882423 ATGTATTTTGATAAGCATACTGG + Intergenic
1012751539 6:103169305-103169327 ATGTAACAAAATAAGCATCAAGG - Intergenic
1013690746 6:112639768-112639790 AAGTATCAAAATAAGCATTAGGG - Intergenic
1014358339 6:120440718-120440740 CTGTAAATAAATAAGCATAATGG + Intergenic
1016155447 6:140801103-140801125 GTGGATCTCAATAAACATAGAGG - Intergenic
1016508456 6:144812404-144812426 ATGTATCACAAGAAGCAGCAAGG - Intronic
1017200513 6:151749056-151749078 ATATAAATCAATAAGCATAATGG + Intronic
1020996322 7:15269880-15269902 AGCTATCTCACTAAGGATAAGGG + Intronic
1021401669 7:20216932-20216954 AAATATCTCAAAAAGCATACAGG - Intronic
1022857123 7:34326029-34326051 ATGTATTTTAATAAGCACATTGG + Intergenic
1024584332 7:50827916-50827938 ATTTGTTTCAATCAGCATAATGG - Intergenic
1026528782 7:71179177-71179199 ATTTATCTCAATGAGCAGAGGGG - Intronic
1030670445 7:112330004-112330026 ATGAAACTCAATAATAATAAAGG + Intronic
1030714591 7:112792617-112792639 ATGTACCTTAGTTAGCATAAAGG + Intergenic
1031928328 7:127659621-127659643 ATGTATATCAAGAGGAATAAAGG + Intronic
1038113572 8:24527532-24527554 ATGCATTTTAATAAGCATAATGG - Intergenic
1039128625 8:34234179-34234201 AAGCATCACAATAATCATAAAGG - Intergenic
1042312169 8:67389717-67389739 ATTTATCTCATTAAGCAAATAGG + Intergenic
1043007449 8:74837169-74837191 ATGTATATCAAAAAATATAAAGG - Intronic
1043010988 8:74881279-74881301 ATGTATTTCTATAATAATAATGG + Intergenic
1043577090 8:81670314-81670336 ATCTACATCAATAAACATAAAGG + Intronic
1046339333 8:112831579-112831601 ATGTAACTCAATTAGTATTAAGG - Intronic
1047350450 8:124068595-124068617 ATGTATCTCAATTCCCTTAATGG + Intronic
1049168981 8:141146366-141146388 ATGTTTCTCAACAAACAAAAGGG - Intronic
1049449465 8:142652545-142652567 ATTTATCTCAATGAGCAGAGGGG + Intergenic
1050493011 9:6209346-6209368 ATGTTTCTCACTATGTATAAGGG - Intergenic
1050646419 9:7724530-7724552 ATGTATCACAATAATTAAAAGGG - Intergenic
1051617836 9:19023329-19023351 ATGTTATTAAATAAGCATAAAGG - Intronic
1052657447 9:31380957-31380979 ATTTATTTCATTAAGCATATAGG - Intergenic
1054933368 9:70660286-70660308 ATTTATCTCAGTAAGCAGAGGGG - Intronic
1055005659 9:71503196-71503218 ATGTATATTAATAGGCAAAAAGG + Intergenic
1056099894 9:83291342-83291364 AGGTATCTCATTAAGCCTATTGG + Intronic
1058607598 9:106740095-106740117 ATATATCTCAATGACCTTAATGG + Intergenic
1061566175 9:131441997-131442019 ATTAATCTTAATAAGGATAAAGG - Intronic
1185745206 X:2567057-2567079 ATGACTGTCAATAAGGATAAAGG - Intergenic
1185811475 X:3114430-3114452 ATCTATCTCAGTGAGCAGAAGGG + Intergenic
1186147698 X:6641987-6642009 ATTTATCTCAGTGAGCAGAAGGG - Intergenic
1186189961 X:7058287-7058309 TTGTATTTCACTAAGCAAAAGGG - Intronic
1186649080 X:11539855-11539877 ATGAAAATCAATAAGCTTAATGG + Intronic
1189748213 X:44191668-44191690 GTTTATCTCAATTAGCCTAAGGG + Intronic
1192771282 X:74195114-74195136 AGGAATCTCAGTAACCATAACGG - Intergenic
1194151812 X:90334742-90334764 CTTTATCTTAAAAAGCATAAAGG + Intergenic
1194160106 X:90438637-90438659 ATGTTTGTTAATAAGCAGAAGGG + Intergenic
1194167045 X:90530011-90530033 ATTTATCTCAGTGAGCATAGGGG - Intergenic
1194594323 X:95838245-95838267 ATTTATCTCAATGAGCAGAGGGG + Intergenic
1197858769 X:130947935-130947957 ATGTACCACCATATGCATAACGG + Intergenic
1198978751 X:142368901-142368923 ATGTAACTATATAATCATAATGG + Intergenic
1199254333 X:145701194-145701216 ATGTGTTTCAATTAACATAATGG + Intergenic
1200513313 Y:4107786-4107808 ATTTATCTCAGTGAGCATAGGGG - Intergenic