ID: 968322936

View in Genome Browser
Species Human (GRCh38)
Location 3:197787442-197787464
Sequence TCTACTGAGTAGAAGGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968322929_968322936 17 Left 968322929 3:197787402-197787424 CCTAGAAGTGGAGTCTTAGAAGG 0: 1
1: 0
2: 2
3: 28
4: 333
Right 968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 173
968322928_968322936 21 Left 968322928 3:197787398-197787420 CCGGCCTAGAAGTGGAGTCTTAG 0: 1
1: 0
2: 0
3: 7
4: 115
Right 968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 173
968322927_968322936 22 Left 968322927 3:197787397-197787419 CCCGGCCTAGAAGTGGAGTCTTA 0: 1
1: 0
2: 1
3: 25
4: 260
Right 968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968322936 Original CRISPR TCTACTGAGTAGAAGGGGGA AGG Exonic
901281257 1:8036994-8037016 TTTACTGAGTAGGAGATGGAGGG + Intergenic
902588782 1:17458720-17458742 TCTCTTGGGGAGAAGGGGGAGGG - Intergenic
902644774 1:17790701-17790723 TTTCCTGGGTAGAAGGGGGTGGG - Intronic
904414914 1:30354586-30354608 TCTACTGAGTGGAAAGGGAAGGG - Intergenic
904975373 1:34452093-34452115 TCTCCTGAGTGGAGGGAGGATGG - Intergenic
905070456 1:35220662-35220684 TCTCCTGAGTGGAAGGGTAATGG - Intergenic
905275765 1:36816984-36817006 TTTACTGAGCAGAAGAGGAAAGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908401928 1:63779508-63779530 TCTCTGGAGTTGAAGGGGGAGGG + Intronic
908531844 1:65041237-65041259 TTTACAGTGTTGAAGGGGGAAGG + Intergenic
910488287 1:87740078-87740100 TTTACTGAGGAGAAAAGGGAGGG + Intergenic
914449338 1:147776894-147776916 TCTATTGTATAGAAGGAGGAGGG - Intergenic
915073066 1:153288381-153288403 TCTGCTGAGTGGTAGGGGGTTGG + Intergenic
919967379 1:202541599-202541621 ACTACTCAGTATAAGAGGGAAGG - Intronic
921247923 1:213265529-213265551 TCTACTGACTAAAATGTGGAAGG - Intronic
921706000 1:218323603-218323625 GCTTCTGGGTAGAAGGGGGAGGG - Intronic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
923306137 1:232690551-232690573 GCTGCTGAGTAGACGGGGGCCGG - Intergenic
1064016867 10:11779574-11779596 TCTCCTGAGAGGCAGGGGGAAGG + Intergenic
1064723628 10:18255279-18255301 TCTACGTGGTAGAAGGGAGAAGG - Intronic
1068559582 10:58498550-58498572 TGAACTGGTTAGAAGGGGGAAGG - Intergenic
1076236618 10:128868531-128868553 TTTACTGAGTGTAAGGGGTAGGG + Intergenic
1076387801 10:130070611-130070633 TCTACTGAGTGGAAGGGCTCAGG - Intergenic
1079888346 11:26017307-26017329 TCTACTGGGTACAAGGGGTATGG + Intergenic
1081838322 11:46176183-46176205 GGTTCTGAGTAGAAGGGGGTGGG - Intergenic
1085618533 11:78020424-78020446 TCTGCTGACTGGAAGGGAGAAGG + Intronic
1086260182 11:84930552-84930574 TCTACTAAGTGGAATGAGGATGG - Intronic
1088117118 11:106325094-106325116 TCTGCTCAGTAAAAGGAGGATGG - Intergenic
1088823347 11:113474851-113474873 GCTACTGAGAAGGAGGGAGAGGG + Intronic
1090696764 11:129252594-129252616 TCATCTGAGTAGGAGGGGCAAGG + Intronic
1092368360 12:7895897-7895919 TCTATTGAGGTGAAGGGTGAAGG - Intergenic
1093924627 12:24897141-24897163 ACTACTTAGTAAAAGGGGAAGGG + Intronic
1093948070 12:25133534-25133556 TCTTCTGTGCTGAAGGGGGAAGG - Intronic
1095992819 12:48049282-48049304 AATTCTGACTAGAAGGGGGAAGG + Intronic
1096730298 12:53605730-53605752 TTTTCTGACTAGAAAGGGGATGG + Intronic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1099494062 12:83322882-83322904 TCTGATGAGTAGATGGAGGAAGG + Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1102549771 12:113683376-113683398 TCTACTGAGTAGATCTGGGTTGG + Intergenic
1104241117 12:126990524-126990546 TCTCCTGACTACAAGGGAGATGG - Intergenic
1106504583 13:30360208-30360230 TCCTCTGAGTAGGAGGGGCAGGG - Intergenic
1106677954 13:31981759-31981781 TCTACTGAATGGAGGAGGGAAGG - Intergenic
1107553694 13:41499419-41499441 GCTAGTGAGTAGCTGGGGGAGGG - Intergenic
1110928139 13:81181797-81181819 TCTCCTTGGTTGAAGGGGGAAGG + Intergenic
1115223976 14:31084875-31084897 TCTACTGAATAGCCAGGGGAGGG + Exonic
1116656808 14:47664424-47664446 TATCTGGAGTAGAAGGGGGAGGG - Intronic
1117560130 14:56929074-56929096 TCTTCCGAGTACAAGGGGAAGGG - Intergenic
1118850546 14:69579888-69579910 TCTACTGAGAGGAAGGAGAATGG - Intergenic
1118947036 14:70398327-70398349 TCTCCTGGGTGGAAGGGGGTTGG - Intronic
1118986354 14:70759076-70759098 GCTAGGGAGTAGAAGGGGGAAGG + Intronic
1120565960 14:86057285-86057307 TCTACTGATAAGAAAGGTGAAGG + Intergenic
1120898837 14:89558448-89558470 TCTCCTGAGTGGATGGGGAATGG + Intronic
1121773442 14:96573329-96573351 TTTGCTGAGTGGAAAGGGGATGG + Intergenic
1121940951 14:98070168-98070190 TCTACCAGGAAGAAGGGGGAAGG - Intergenic
1122365308 14:101191710-101191732 TCTACTTAGTAGCTTGGGGATGG - Intergenic
1124215389 15:27803958-27803980 TCCACTGGGTAGAAGCGTGATGG + Intronic
1125752359 15:42037187-42037209 GCTCCTGGGTAGAAGGGGGTGGG + Intronic
1126112943 15:45186415-45186437 TCTGCTGAGGAGAAGGGGGCAGG + Intronic
1126383464 15:48071013-48071035 TCTACTGAGAAGCAGAGAGAAGG + Intergenic
1127814845 15:62598903-62598925 TCTAGTGAGGAGGAGTGGGAAGG - Intronic
1132906898 16:2287091-2287113 TCTCCTTAGGAGAAGGGTGATGG - Intronic
1133054343 16:3138108-3138130 TCTAATGAGTGGCTGGGGGATGG + Intronic
1134038410 16:11049618-11049640 GCTTCTGAGTGGAAGGGGGTGGG + Intronic
1135674254 16:24401990-24402012 TGTGTTGAGGAGAAGGGGGAGGG - Intergenic
1138827487 16:60337990-60338012 ACTACTGAGTACAAAGGAGAGGG - Intergenic
1141249955 16:82346689-82346711 TCTACGGGGTTAAAGGGGGAAGG + Intergenic
1142320295 16:89377891-89377913 TTCATTGAGTAGAAGGAGGAGGG - Intronic
1142779479 17:2169843-2169865 ACTGAAGAGTAGAAGGGGGAAGG + Intronic
1143988150 17:10933307-10933329 TTTACATAGTAGAAGGGGAAGGG + Intergenic
1146082102 17:29789687-29789709 TCCACTGAGCTGAAGGGGCAGGG + Intronic
1147926911 17:43952170-43952192 TCTACTCAGGGAAAGGGGGACGG + Intergenic
1149357629 17:55859226-55859248 GCTACTGGGTAGAGGTGGGAGGG - Intergenic
1149443138 17:56691712-56691734 TCTAGTAAGAAGAAAGGGGAAGG - Intergenic
1149912303 17:60577757-60577779 TCTACTGAGCTGAGGAGGGAGGG + Intronic
1152024912 17:77802720-77802742 TCTAGGTAGCAGAAGGGGGAGGG - Intergenic
1159541186 18:69778910-69778932 CCTAATGAGTGGAATGGGGATGG + Intronic
1160182947 18:76651355-76651377 TTTACTTAGTAGAAGGAGCAGGG + Intergenic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1168156745 19:54477717-54477739 TCTTCTGAGTAGCAGGGACATGG + Intergenic
930602397 2:53457355-53457377 TCTAGACAGTAGAATGGGGATGG - Intergenic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
931321910 2:61180328-61180350 TGTTCTGAGGCGAAGGGGGAAGG - Intronic
932054768 2:68432943-68432965 GCTCCTGAGTAGAAGTGGGTGGG - Intergenic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934655569 2:96115374-96115396 TCCACTGGGGAGAAGGAGGAGGG - Exonic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
941673438 2:168319306-168319328 GCAGCTGAGTAGAAGGAGGATGG + Intergenic
942101776 2:172590918-172590940 TATACTGTTTAGAGGGGGGATGG - Intronic
942611818 2:177750018-177750040 TTTACTGAGCAGAAGTGGCAAGG - Intronic
942907212 2:181198439-181198461 TGTACTGTGTAGAAGGGAAAGGG - Intergenic
944530867 2:200666903-200666925 TTTACTGTTTAAAAGGGGGAAGG + Intronic
945612720 2:212025170-212025192 TTTACAGAGTAGAATGAGGAGGG + Intronic
947228612 2:227863422-227863444 TTAACTGGGTAGAAGGGAGAAGG + Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
1170552318 20:17488642-17488664 TCTCCTGAGGAGAAATGGGATGG + Intergenic
1171970517 20:31562158-31562180 TCTACTAGGGAGTAGGGGGAGGG - Intronic
1172941081 20:38655185-38655207 TCTTCTGAGAGGAAGGAGGATGG + Intergenic
1175814359 20:61875859-61875881 GCTACAGAGGAGATGGGGGACGG - Intronic
1176053423 20:63132760-63132782 TCTGCTGAGGAAAAGGTGGACGG + Intergenic
1176068571 20:63214099-63214121 ACAACTAATTAGAAGGGGGACGG + Intronic
1176664316 21:9670457-9670479 TCTGCTGAAGAGAAGTGGGATGG - Intergenic
1180235446 21:46456817-46456839 TCTACTGAGCAGTAAGTGGAGGG + Intergenic
1181547944 22:23614344-23614366 TCCCCTGAGTGGAAGAGGGATGG + Intronic
1181548720 22:23622306-23622328 TCCCCTGAGTGGAAGAGGGATGG + Intronic
1182107357 22:27698852-27698874 TCTGCTAAGTAGATGAGGGAAGG - Intergenic
1184495768 22:44840438-44840460 TCTAGTGAGCAGAAGGGAGAGGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
952681000 3:36092655-36092677 TCAACTGAATAGAAGGGGCCAGG + Intergenic
952903733 3:38126398-38126420 TCTGCAAAGTAGAAGTGGGAGGG - Intronic
952931908 3:38367079-38367101 TCTCCTGACCAGAAGGGTGAGGG + Intronic
952936198 3:38400148-38400170 GCAAATGAGTAGCAGGGGGAAGG - Intronic
953450820 3:43004476-43004498 TCTACTGAGAAGAGGGTGGGTGG - Intronic
954737002 3:52715046-52715068 GCTACTGGGCAGAAGGGGGCGGG + Intronic
955761663 3:62291332-62291354 GGTACTGAGTAGAAGGGCTAGGG - Intronic
958841631 3:99211645-99211667 TCTATTGAGTAGAATGGGGTAGG - Intergenic
964861417 3:161206287-161206309 TCTACTGAGTTTATGGGTGATGG - Intronic
965470614 3:169085734-169085756 TCTGCTGAGCAGAAGGTGCATGG + Intronic
965772616 3:172196676-172196698 TATCCTGAATAGAAGAGGGAGGG + Intronic
965951393 3:174312243-174312265 AGTCCTGAGTAGACGGGGGAAGG - Intergenic
968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG + Exonic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
972765126 4:42145814-42145836 TCTACTGAGTAGAAGAGATCTGG - Intronic
973942346 4:55923801-55923823 TCCTCTAAGTAGAAGGGCGATGG + Intergenic
974788389 4:66652903-66652925 TCAACTGAGTAGAAAGTGTAAGG - Intergenic
976328026 4:83795205-83795227 TGTACTTAATAAAAGGGGGATGG - Intergenic
976529201 4:86131984-86132006 TCTACTGACTAGAAGCAGAAAGG - Intronic
978138707 4:105293867-105293889 TGTGCTGATTAGCAGGGGGATGG + Intergenic
980191436 4:129529835-129529857 TCTCCTGAGTAGAAGCTGTATGG - Intergenic
983558309 4:169077615-169077637 TCTTCTCAGTAGAAGGGGCTAGG - Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
985409780 4:189671136-189671158 TCTGCTGAAGAGAAGTGGGATGG - Intergenic
985416650 4:189742150-189742172 TTTCCTGAGTAGAATGGAGATGG + Intergenic
986363517 5:7005600-7005622 TTTACAGTGTAGAAGGGAGAAGG + Intergenic
990596962 5:57321812-57321834 TCCACTGTGTAGCAGAGGGATGG + Intergenic
994449969 5:99929536-99929558 TCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1000407158 5:160900162-160900184 ACTACTCAGTAGTTGGGGGAAGG - Intergenic
1002001837 5:176200435-176200457 TCCCCTGTGTAGAAGGGGGAAGG - Intergenic
1002252501 5:177938543-177938565 TCCCCTGTGTAGAAGGGGGAAGG + Intergenic
1002593500 5:180306930-180306952 TCTACTGAGGAGAAAGGGACAGG - Intronic
1006225853 6:32535530-32535552 TCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1007019278 6:38503309-38503331 TCTCCTGGAGAGAAGGGGGAGGG - Intronic
1008209210 6:48701200-48701222 TTTGCTGAGGTGAAGGGGGATGG - Intergenic
1008707676 6:54182376-54182398 ACTACTGGGGAGTAGGGGGAAGG + Intronic
1012360366 6:98369892-98369914 TTTACTTGGTAGAAGGGGCAAGG - Intergenic
1013335936 6:109161213-109161235 TATAGTGAGTAGAACAGGGATGG + Intronic
1013401118 6:109797111-109797133 TCCACTGGGTAGAAGTGGGATGG + Intronic
1015578761 6:134701431-134701453 ACTCCTGTGTAGAAAGGGGAGGG - Intergenic
1016277023 6:142365910-142365932 TCAACTCAGTAAAAGAGGGAGGG + Intronic
1016326810 6:142912420-142912442 TGTGATGAGGAGAAGGGGGAAGG - Intronic
1017364863 6:153623579-153623601 TCTACTTTGTAGAAAGGAGAGGG - Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1022253774 7:28635101-28635123 TCTACTAACTAGAAGTGGTATGG - Intronic
1023308853 7:38861434-38861456 TCCAGTGGGTAGAAGAGGGAAGG + Intronic
1023720460 7:43088265-43088287 TCTAATGAGTAGAATGTGGCAGG + Intergenic
1026106163 7:67422431-67422453 TCTACAGACTGGGAGGGGGATGG + Intergenic
1028280501 7:88920615-88920637 TCTACTTAGCAGAAGGGGTGTGG + Intronic
1029116608 7:98241015-98241037 TGTACTGGGGAGAAGGGTGAGGG - Intronic
1030235995 7:107262719-107262741 TCAACTGAGAATAAGGAGGAGGG - Intronic
1030570263 7:111213432-111213454 GCTCCTGAGTGGAAGGGGGTGGG + Intronic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032858630 7:135858049-135858071 GCTCCTGAGTGGAAGGGGGTGGG - Intergenic
1034454279 7:151157656-151157678 GCTACTGAGCAAAAGGGGGAAGG - Intronic
1035343175 7:158177869-158177891 TGTCTTGAGTAGAAGTGGGATGG + Intronic
1035629589 8:1097529-1097551 TCTACTGAGCAGAGGGAGGTGGG - Intergenic
1042071241 8:64937351-64937373 TCAACTGAATAGAAGGGGTGGGG + Intergenic
1042384445 8:68156704-68156726 TCTACTGAGAAGAAGGGTCTAGG + Intronic
1042977302 8:74483773-74483795 TCTACTTAGGAGAAGTTGGAGGG + Intronic
1043591296 8:81836151-81836173 TGTAGTGAGTAGAATTGGGAAGG - Intronic
1044065177 8:87689862-87689884 TCCTCTGAGAAGAATGGGGAGGG - Intergenic
1048866477 8:138765229-138765251 TCTACTGCCTTGGAGGGGGAGGG + Intronic
1050735673 9:8759977-8759999 TCTCCTGATTAGTAGGGAGAAGG - Intronic
1051548520 9:18303739-18303761 TCTAATGAGGAGAAGGGTGATGG + Intergenic
1055689273 9:78811730-78811752 TCTCCTAAGTACAAGGGAGAGGG + Intergenic
1060293115 9:122322693-122322715 TCTTCTGTGTAGATGGGGGAGGG - Exonic
1061496974 9:130980697-130980719 TCTAATGAGGAGCAGGTGGATGG - Intergenic
1203661785 Un_KI270753v1:51295-51317 TCTGCTGAAGAGAAGTGGGATGG + Intergenic
1203672976 Un_KI270755v1:34344-34366 TCTGCTGAAGAGAAGTGGGATGG + Intergenic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1187960078 X:24559855-24559877 TCTACTGAGAAGGAATGGGAAGG - Intronic
1187984916 X:24799742-24799764 TTTACTGAGTTAAAGGGTGAGGG + Intronic
1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG + Intronic
1191221237 X:57990070-57990092 GCTCCTGAGTGGAAGAGGGAGGG + Intergenic
1196464712 X:115960268-115960290 TGTGCTCAGGAGAAGGGGGAAGG - Intergenic
1197140955 X:123116869-123116891 TCTTCTGTGTGGATGGGGGAGGG + Intergenic
1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG + Intronic
1200239166 X:154484862-154484884 TTTACTGAACAGAAGGGAGAGGG + Exonic