ID: 968324544

View in Genome Browser
Species Human (GRCh38)
Location 3:197801594-197801616
Sequence TAAGTGCCTAACTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968324544 Original CRISPR TAAGTGCCTAACTGGGGAGG AGG (reversed) Intronic
901012687 1:6210328-6210350 TCAGTGCCTGGCCGGGGAGGAGG - Intronic
902210966 1:14904216-14904238 GAATTGCCTCACTTGGGAGGCGG + Intronic
902275081 1:15333776-15333798 TACCTGCCTCACTGGGTAGGTGG - Intronic
903101759 1:21035902-21035924 TATGGGCCTTACAGGGGAGGTGG - Intronic
904316017 1:29664089-29664111 AAAGAGCCAAACTGGGGAGAGGG + Intergenic
904828097 1:33288655-33288677 TAATCGCTGAACTGGGGAGGCGG + Intronic
905785828 1:40756808-40756830 TGAGTGCCTACCTGGGAACGCGG + Intronic
907544535 1:55248127-55248149 TAAGTGCCTAAATGCTGAAGAGG - Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
913998988 1:143676373-143676395 TGATTGCCTAAATGGGGATGGGG - Intergenic
914201552 1:145489367-145489389 TGATTGCCTAAGTGGGGATGGGG - Intergenic
914480674 1:148062494-148062516 TGATTGCCTAAGTGGGGATGGGG - Intergenic
914509625 1:148319442-148319464 TGATTGCCTAAGTGGGGATGGGG - Intergenic
915769453 1:158404508-158404530 TGAGTGCCTGAGTGGGAAGGTGG - Intergenic
918214786 1:182384154-182384176 TTAGTGCATTAGTGGGGAGGAGG - Exonic
919824874 1:201496284-201496306 AGAATGCCGAACTGGGGAGGAGG - Exonic
920669302 1:207991073-207991095 TAATTGCCTCACTGGGGACTGGG + Intergenic
922957758 1:229618753-229618775 TTAGAGCCTAACGGGGGTGGGGG - Intronic
1065102133 10:22341105-22341127 GAAGTTTCTAACGGGGGAGGCGG - Intergenic
1069195538 10:65546288-65546310 TAAGAGCTGGACTGGGGAGGGGG - Intergenic
1072294412 10:93995138-93995160 TGAGAGCCTGACTTGGGAGGTGG + Intronic
1076283837 10:129274561-129274583 TAAGTGCGACACTGGAGAGGTGG - Intergenic
1077283564 11:1756212-1756234 TGAGTGCCCACATGGGGAGGGGG - Intronic
1077923292 11:6656572-6656594 AAAGTGACTAACAGGGGAGAAGG - Intergenic
1081080173 11:38731744-38731766 TAAGAGCCTGACTGGGGCTGCGG + Intergenic
1086880736 11:92150570-92150592 TTATTTCCTAAGTGGGGAGGAGG - Intergenic
1087182244 11:95151735-95151757 TCCCTGCCTAACTGGTGAGGTGG + Intergenic
1087740711 11:101883707-101883729 TGATTCCCTAACTGGGAAGGTGG + Intergenic
1090776225 11:129968446-129968468 TGAGTGCCAGTCTGGGGAGGGGG + Intronic
1093533330 12:20193564-20193586 TAAGTGGTTGCCTGGGGAGGGGG - Intergenic
1094468608 12:30781304-30781326 TAAGTGGTTAACTGGGAATGAGG + Intergenic
1094809516 12:34123991-34124013 CAATTGCCTCTCTGGGGAGGGGG + Intergenic
1097713638 12:62941753-62941775 TAAATGCATGACTGGGGAGGGGG - Intergenic
1099772645 12:87081929-87081951 TAAGTGCCTAAAGGAGGAGTTGG + Intergenic
1101199319 12:102418186-102418208 TTGGTTTCTAACTGGGGAGGGGG - Intronic
1103893357 12:124256282-124256304 TAGGTGGTTACCTGGGGAGGGGG - Intronic
1106264579 13:28098936-28098958 ATAGTGGCTACCTGGGGAGGGGG + Intronic
1106416232 13:29548365-29548387 TAACAGCCTCACTGGGGAGATGG + Intronic
1111677163 13:91400707-91400729 TCAGGGCCTTACTGGGGAGAAGG - Intronic
1111913935 13:94341496-94341518 GAATTGCTTAACCGGGGAGGTGG + Intronic
1112370473 13:98788774-98788796 TTCCTGCCTCACTGGGGAGGGGG - Intergenic
1112873348 13:104002589-104002611 GAAGAGGTTAACTGGGGAGGAGG - Intergenic
1116067592 14:40003841-40003863 TAAGTGAGTTAGTGGGGAGGAGG + Intergenic
1116869447 14:50057405-50057427 TAAGTGCTCACATGGGGAGGGGG - Intergenic
1119112578 14:71988797-71988819 GGAGGGTCTAACTGGGGAGGGGG + Intronic
1121285174 14:92729475-92729497 TAAGTGTTTAACGGGGGCGGGGG - Intronic
1125675407 15:41499702-41499724 CAAGTGCCTCTGTGGGGAGGCGG + Intronic
1127626107 15:60781671-60781693 TGAGTGCCTCCCTGGGGTGGGGG + Intronic
1129141460 15:73601916-73601938 AAATTGCATAACTGGGGATGGGG + Intronic
1129886771 15:79043680-79043702 GAAGTGGCTACCTGGGGAGATGG + Intronic
1131406804 15:92171764-92171786 TCTGTGCCTAAAGGGGGAGGAGG - Intronic
1132134713 15:99324168-99324190 TAAGTGACTAATGGGCGAGGAGG + Intronic
1134356019 16:13483025-13483047 TAAGTGCCCATCTGTGGAAGCGG - Intergenic
1134829321 16:17310544-17310566 TAAGTGCATAAATGGGGAAAAGG + Intronic
1135975593 16:27107269-27107291 TAAATTCTTTACTGGGGAGGGGG - Intergenic
1138225684 16:55292404-55292426 TAAGGGAGTAGCTGGGGAGGGGG + Intergenic
1138821920 16:60270902-60270924 TTACTGCCTCACTGAGGAGGTGG - Intergenic
1141289232 16:82702373-82702395 TCAGTGTCTAGCAGGGGAGGTGG - Intronic
1141696006 16:85619760-85619782 TCAGTCCCTCCCTGGGGAGGAGG - Intronic
1143515853 17:7418862-7418884 TCCGTGCCAAACTGGGTAGGTGG + Exonic
1143582017 17:7833253-7833275 TAAGTTCCAAACTAGGGACGGGG - Intronic
1146710772 17:35039614-35039636 AAAGAGCTTTACTGGGGAGGGGG - Intronic
1146976441 17:37116954-37116976 TAGGTTCCTCACTGGAGAGGCGG + Intronic
1147488357 17:40840581-40840603 GAATTGCTTAACTTGGGAGGCGG - Intergenic
1147557090 17:41486455-41486477 TGAGTGCCAACCTGGGGAGCCGG + Exonic
1148734688 17:49858800-49858822 GCAGTGCCAAACTGGGGAGAGGG + Intergenic
1149612790 17:57969935-57969957 TAAGTGCCTATCTTGGGAAGAGG + Intergenic
1156170555 18:34479613-34479635 ATAATGCCTAACTGGGGAGATGG - Intergenic
1163030853 19:14543202-14543224 CAAGTGTCTAACTCAGGAGGTGG + Intronic
1163632638 19:18425126-18425148 TAAGTGCCTAACCCAGGAGGTGG - Intronic
1163787813 19:19285492-19285514 TAAGTGCCCTATTGGGGTGGGGG + Intronic
1164501723 19:28826002-28826024 GAATTGCTTAACTCGGGAGGTGG + Intergenic
1166422598 19:42650540-42650562 TCAGTTCCTAGCAGGGGAGGTGG - Intronic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
932730663 2:74219813-74219835 TAGGAGCCTGACTGGGGAAGTGG + Intronic
933531399 2:83517105-83517127 TGAGTGCCCAACTGTGGAAGTGG + Intergenic
935501244 2:103842365-103842387 TAAGTGCCAAAAAAGGGAGGAGG + Intergenic
936503149 2:113082401-113082423 CAAGTGCAGAACTGGGCAGGGGG + Intergenic
936863314 2:117047828-117047850 TGAGGCCCTAACTGGGGAGGGGG + Intergenic
938276865 2:130034211-130034233 TTAGAGCCTACATGGGGAGGAGG - Intergenic
943293311 2:186103896-186103918 TAAGAGCCTAACTTAGGTGGAGG + Intergenic
944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG + Intergenic
945689723 2:213018527-213018549 TAAATGCCTACCTGGGGCAGGGG - Intronic
1185056352 22:48580621-48580643 TGAGTGTCTAACGGTGGAGGAGG + Intronic
951836282 3:26986798-26986820 AAAGTGCCTAAGAGGAGAGGGGG - Intergenic
951922898 3:27875327-27875349 CAAGAGCCTATTTGGGGAGGAGG - Intergenic
955581690 3:60429833-60429855 TAAGAGGCTAAGTGAGGAGGTGG + Intronic
955730895 3:61985273-61985295 TAAGTTCCCTCCTGGGGAGGTGG + Intronic
955920262 3:63947717-63947739 ATAGTAACTAACTGGGGAGGGGG + Intronic
956757040 3:72398931-72398953 TAAGTGCCTGATTGTGGGGGAGG + Intronic
959645339 3:108693169-108693191 TAAATGCATGACTGGGGAGGGGG + Intronic
961066665 3:123882471-123882493 TAACTGGCTAGCTGAGGAGGAGG - Intronic
964519631 3:157550468-157550490 AAAGTGTCAAAATGGGGAGGAGG - Intronic
967100540 3:186211771-186211793 TAAGTTCCCAAGTGGGGAGAAGG - Intronic
967399637 3:189046289-189046311 TCAGTGCCTAAGTGGAGAAGAGG - Intronic
968324544 3:197801594-197801616 TAAGTGCCTAACTGGGGAGGAGG - Intronic
968713333 4:2136782-2136804 AAGGTGCCAAACTGGGGAGGTGG + Intronic
969460310 4:7325543-7325565 TAAGGGCCTAAATGGGGCTGGGG + Intronic
973628564 4:52797034-52797056 GGAGTACCTAACTGGGGAGGTGG - Intergenic
980086240 4:128393202-128393224 AAATTACCTAAGTGGGGAGGGGG + Intergenic
981204126 4:142018629-142018651 TAAGTGAATCACGGGGGAGGGGG - Intergenic
982642717 4:157983375-157983397 TAAGTGGAAAACTGCGGAGGTGG - Intergenic
986231080 5:5865211-5865233 TCAGTGCCTAGCTGAGGATGAGG - Intergenic
986779895 5:11055631-11055653 TTAGGTCCTAACTGGGGAGATGG - Intronic
988180010 5:27778343-27778365 TAAGTGACTAATGGGGTAGGCGG - Intergenic
989816353 5:45742329-45742351 TAAGAGCCAAACTAGGGAGGTGG - Intergenic
990616963 5:57518507-57518529 TCAGTTCCTAAATGGGGTGGCGG + Intergenic
990793773 5:59516276-59516298 AAAGTGACTGCCTGGGGAGGAGG - Intronic
992291605 5:75285315-75285337 TAAATGCATATCTGGGCAGGGGG + Intergenic
993294904 5:86124694-86124716 TAAGGGCCTAACTTGAGTGGGGG + Intergenic
994475005 5:100256549-100256571 TTAATGCTTAACTGGGGAGGGGG - Intergenic
995837382 5:116412118-116412140 TAGGTGCCATAGTGGGGAGGGGG - Intronic
996945499 5:129062245-129062267 TAAGTGACTAACAGGTGGGGTGG + Intergenic
998902002 5:146865877-146865899 GAAGTGGTTAAGTGGGGAGGTGG - Intronic
1000281375 5:159785279-159785301 TAAGTGTCTTCCTGGGGTGGGGG + Intergenic
1003398469 6:5772633-5772655 TAAGTGCCTAACCAGTCAGGGGG - Intergenic
1003874515 6:10424037-10424059 CAAGTGCATAACATGGGAGGGGG - Intergenic
1006390952 6:33758149-33758171 TATGTGACTACCTGGAGAGGAGG + Intergenic
1006625956 6:35397917-35397939 GAGGTGGGTAACTGGGGAGGGGG + Intronic
1006935898 6:37717461-37717483 TAAGAGTCCACCTGGGGAGGTGG + Intergenic
1007763834 6:44149769-44149791 CAAGGGCCCAGCTGGGGAGGAGG + Intronic
1020915121 7:14183961-14183983 TGAGTGCCCAACTGAGGAAGTGG + Intronic
1024716835 7:52088493-52088515 TAAGTCCCACACTGGGGAAGGGG + Intergenic
1028617948 7:92791158-92791180 TAAGTGTCTAAATGTGGCGGGGG + Intronic
1035519676 8:266430-266452 TCAGTGCCCACCTGGGGAGGGGG + Intergenic
1036202879 8:6784109-6784131 TGAGTGGCTGAGTGGGGAGGGGG - Intergenic
1038413431 8:27375730-27375752 CCCGTGCATAACTGGGGAGGAGG - Intronic
1039776085 8:40738199-40738221 TAAGAGTCGAACTGGGGAGTTGG + Intronic
1041213646 8:55578431-55578453 TATGTGACCAACTGGGGAGGGGG + Intergenic
1042870839 8:73397745-73397767 TAAGTGTCTAACTTAAGAGGTGG + Intergenic
1043186149 8:77152455-77152477 TAGGGACCTAAATGGGGAGGTGG - Intergenic
1044578410 8:93796836-93796858 TAAGTCCCTATGTGAGGAGGAGG + Intronic
1047499118 8:125429193-125429215 TGAGTGCCAACCTGGGTAGGTGG - Intergenic
1047885799 8:129248963-129248985 TAAGTGACTCAGTGGAGAGGTGG - Intergenic
1053028818 9:34757052-34757074 AAAGTGCCTAAGTGTGGTGGCGG - Intergenic
1054986749 9:71270571-71270593 TAAGTGAATACCTAGGGAGGAGG - Intronic
1055759188 9:79588752-79588774 TGAGTGCCTGCCTGGGGTGGAGG + Intronic
1059980726 9:119768999-119769021 TAAGTGACTTACTAGGGAAGTGG + Intergenic
1062305416 9:135903894-135903916 TAAGAGACTGAGTGGGGAGGGGG - Intronic
1186744939 X:12557753-12557775 TCAGGGCCCACCTGGGGAGGGGG - Intronic
1186907493 X:14127271-14127293 TAAGTGCCTCACGTGGGAAGTGG + Intergenic
1188811108 X:34655931-34655953 TAAGGGCATAACTGGGGCGCCGG + Intronic
1189508771 X:41639750-41639772 TCAGTGGCTGACTGGGGATGGGG - Intronic
1191785819 X:64916567-64916589 TCAGTACCTGGCTGGGGAGGGGG - Exonic
1192148089 X:68694976-68694998 TCAGAGCCTAAGCGGGGAGGAGG + Intronic
1193251817 X:79299462-79299484 TAAGAGCAGAACTGGTGAGGAGG + Intergenic
1196500227 X:116372389-116372411 TAGGTGCCTAACAGGAGAAGAGG + Intergenic
1199184819 X:144903557-144903579 TGAGGGGCTAAGTGGGGAGGTGG + Intergenic
1200075310 X:153547783-153547805 TCAGTGCCTGGCTGGGGAGAAGG - Intronic
1200359982 X:155594295-155594317 AAAGTGCCAAAGTGGGGAGGGGG + Intronic
1201242817 Y:11975208-11975230 AAAATGCCTCAGTGGGGAGGTGG + Intergenic
1202043611 Y:20713992-20714014 TAAGTGCCCAACTGTGAAAGCGG + Intergenic