ID: 968326063

View in Genome Browser
Species Human (GRCh38)
Location 3:197817557-197817579
Sequence TGGCCCACACAGATGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 0, 2: 1, 3: 111, 4: 614}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968326057_968326063 30 Left 968326057 3:197817504-197817526 CCGTACTCAAGTGGTTGGCACAC 0: 1
1: 0
2: 1
3: 6
4: 125
Right 968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG 0: 1
1: 0
2: 1
3: 111
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968326063 Original CRISPR TGGCCCACACAGATGGGAAA AGG Intronic
900045036 1:498957-498979 AGACCCACACAGATGGGATTTGG - Intergenic
900066041 1:730456-730478 AGACCCACACAGATGGGATTTGG - Intergenic
900066835 1:737271-737293 AGACCCACACAGATGGGATTTGG - Intergenic
900067233 1:740687-740709 AGACCCACACAGATGGGATTTGG - Intergenic
900840812 1:5047182-5047204 GGTCCCACACAGATGGGATGCGG - Intergenic
900847501 1:5115457-5115479 GGTCCCACACAGATGGGACGCGG - Intergenic
901611790 1:10504559-10504581 TGGCAGACACAGCTGGGTAAAGG - Intronic
901862685 1:12084963-12084985 AGGGTCACACAGTTGGGAAATGG + Intronic
902768025 1:18630007-18630029 GGGCCCAAAGAGGTGGGAAATGG - Intergenic
903282160 1:22256172-22256194 AGGCCCACAGAGATGCTAAACGG + Intergenic
904711658 1:32434682-32434704 GGTCCCACAGAGATGGGACATGG - Intergenic
905031949 1:34890423-34890445 TGGTCCACACTCATGAGAAAGGG - Intronic
905056533 1:35099402-35099424 TGTCCCAGACAGATTGAAAAAGG + Intronic
905060496 1:35135706-35135728 GGTCCCACACAGATGGGACGTGG + Intergenic
905499802 1:38427416-38427438 GGTCCCACACAGATGGAACACGG - Intergenic
906264916 1:44421469-44421491 TGACACACACAGATGGGGGAAGG - Intronic
906438429 1:45817557-45817579 TGTCCCACACAAATGCTAAAGGG + Intronic
906670941 1:47654262-47654284 TGGGCCACACAGCTAGGAAGTGG + Intergenic
906725885 1:48043948-48043970 TGGCTCTAGCAGATGGGAAACGG + Intergenic
907292654 1:53426631-53426653 GGTCCCACACAGATGGGACGCGG - Intergenic
907521282 1:55024935-55024957 GGTCCCACACAGATGGGACGCGG - Intergenic
907577498 1:55540286-55540308 AGGCCCACCCACATGAGAAAGGG - Intergenic
907795432 1:57711397-57711419 TGGGCTATGCAGATGGGAAAAGG + Intronic
907826722 1:58024761-58024783 AGGCCCACACACATTAGAAAAGG - Intronic
908372497 1:63497092-63497114 TGGGCAACACAGATGGGTACAGG - Intronic
908461692 1:64353343-64353365 GGTCCCACACAGATGGGATGCGG + Intergenic
908591932 1:65645251-65645273 GGTCCCACACAGATGGGACGCGG + Intergenic
908852428 1:68388600-68388622 GGTCCCACACAGATGGGACGCGG - Intergenic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909550998 1:76898149-76898171 GGTCTCACACAGATGGGATACGG + Intronic
909788245 1:79642100-79642122 GGTCCCGCACAGATGGGACACGG + Intergenic
909909983 1:81247774-81247796 GGTCCCACACAGATGGGACGTGG - Intergenic
909978429 1:82070891-82070913 GGTCCCACACAGATGGGACGTGG + Intergenic
910870788 1:91830899-91830921 TGTCCCACTTAGGTGGGAAACGG + Intronic
911570416 1:99511954-99511976 GGTCCCACACAGATGGGACGTGG - Intergenic
911759759 1:101601410-101601432 GGTCCCGCACAGATGGGACATGG + Intergenic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
912296494 1:108475286-108475308 GGTCCCGCACAGATGGGACACGG - Intergenic
912642147 1:111357343-111357365 AGGCCCTCACAGCTGAGAAAAGG - Intergenic
912643779 1:111371787-111371809 TGAACCACACACATGGAAAAAGG + Intergenic
913245149 1:116864437-116864459 GGTCCTACACAGATGGGACATGG - Intergenic
915737797 1:158095542-158095564 TGGCACAGACAGGTGGAAAACGG + Exonic
916328880 1:163593356-163593378 GGTCCCGCACAGATGGGACAAGG - Intergenic
916941813 1:169685202-169685224 GGTCCCACACAGATGGAACATGG - Intronic
917357187 1:174138671-174138693 TGGCCCACACAGTTCTAAAAGGG + Intergenic
917749676 1:178042312-178042334 GGTCCCGCACAGATGGGACATGG - Intergenic
918042505 1:180921781-180921803 TGGGCCTCACAGAGGGCAAAAGG + Intronic
920541716 1:206783786-206783808 AAGGTCACACAGATGGGAAAGGG - Intergenic
920901507 1:210114188-210114210 GGTCCCTCACAGATGGGACATGG + Intronic
921212443 1:212911840-212911862 GGTCCCACACAGATGGGACGCGG - Intergenic
921459756 1:215413319-215413341 GGTCCCACACAGATGGGACGCGG + Intergenic
921520154 1:216147882-216147904 GGTCCCACACAGATGGGACGCGG - Intronic
921714876 1:218407712-218407734 AGGGTCACACAGGTGGGAAATGG + Intronic
921732949 1:218597168-218597190 GGTCCCACACAGATGGGATGCGG + Intergenic
921814613 1:219549564-219549586 TGGAGAACACAGAAGGGAAAAGG - Intergenic
922048435 1:221968290-221968312 GGTCCCGCACAGATGGGACACGG - Intergenic
922598995 1:226835602-226835624 GGGCCTGCACAGATGGGACATGG - Intergenic
922906418 1:229176754-229176776 GGTCCCACACAGATGGGACGCGG - Intergenic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923075230 1:230603564-230603586 GGTCCCGCACAGATGGGACATGG - Intergenic
923244779 1:232120513-232120535 GGTCCCACACAGATGGGACGCGG - Intergenic
923770715 1:236935630-236935652 GGTCCCGCACAGATGGGACATGG + Intergenic
923962809 1:239103705-239103727 GGTCCCGCACAGATGGGACATGG - Intergenic
924775903 1:247114404-247114426 TGCCCCTCACAGATGGAAATGGG - Intergenic
924896159 1:248339606-248339628 GGTCCTACACAGATGGGATATGG + Intergenic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1064663791 10:17630221-17630243 GGTCCCGCACAGATGGGACACGG + Intergenic
1065437655 10:25718781-25718803 GGTCCCACACAGACGGGATATGG - Intergenic
1065443095 10:25772116-25772138 GGTCCCACACAGATGGGACGCGG + Intergenic
1067360428 10:45573547-45573569 GGTCCCGCACAGATGGGACAAGG - Intronic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068230996 10:54169090-54169112 GGTCCCACACAGATGGGACGCGG - Intronic
1068356494 10:55916614-55916636 TGGCCCACACATAAGTGGAAGGG - Intergenic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1070285878 10:75083344-75083366 TGTCCCAGAAAAATGGGAAAGGG - Intergenic
1070377016 10:75842725-75842747 TGGCCCAAAGAGGTGGAAAAGGG + Intronic
1070474949 10:76820904-76820926 GGTCCCACAGAGATGGGACACGG - Intergenic
1070541157 10:77416302-77416324 TGGCCCACACAATAGGGGAAAGG + Intronic
1070719179 10:78744679-78744701 GGACCCACACCCATGGGAAAGGG + Intergenic
1071550769 10:86564614-86564636 GGTCCCGCACAGATGGGACATGG + Intergenic
1071916226 10:90297340-90297362 GGTCCCACACAGATGGGACGCGG - Intergenic
1072580284 10:96734547-96734569 GGTCCCGCACAGATGGGACACGG - Intergenic
1072781584 10:98255431-98255453 TTGGCCACACAGCTGGGAAATGG + Intronic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1075014975 10:118903883-118903905 TTGCCCACACTCATGGGAAGAGG - Intergenic
1075248720 10:120847183-120847205 GGTCCCGCACAGATGGGACACGG - Intergenic
1076700749 10:132271425-132271447 GGGCCCACACTGTTGGGACAAGG - Intronic
1076796302 10:132799980-132800002 TGGCCCACCCAGGTGGAAGACGG - Intergenic
1076971364 11:135448-135470 AGACCCACACAGATGGGATTTGG - Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1077612209 11:3650270-3650292 GGTCCCACACAGATGGGATACGG - Intronic
1078143469 11:8707840-8707862 TGGCCCAGCCAAGTGGGAAAGGG - Exonic
1079447483 11:20570123-20570145 GGTCCCACAGAGATGGGACATGG - Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1080862279 11:36160255-36160277 TGGCCCACACAAAGGGCAGAGGG - Intronic
1081356830 11:42122910-42122932 GGTCCCACACAGATGGGACGCGG - Intergenic
1083461700 11:62817582-62817604 TGACCCATACAGAAGAGAAAAGG + Intronic
1084047189 11:66575953-66575975 GGTCCCACACAGGTGGGACACGG - Intergenic
1084245576 11:67854785-67854807 GGTCCCGCACAGATGGGACATGG + Intergenic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1085636102 11:78160636-78160658 GGGACCACACTGAGGGGAAACGG - Intergenic
1085988039 11:81808549-81808571 GGTCCCACACAGATGGGAAATGG - Intergenic
1086005044 11:82027555-82027577 GGTCCCGCACAGATGGGACATGG - Intergenic
1086125285 11:83343461-83343483 GATCCCACACAGATGGGACATGG + Intergenic
1086514540 11:87596565-87596587 GGACACCCACAGATGGGAAAGGG + Intergenic
1086827489 11:91517657-91517679 TGGCACCCACAAAAGGGAAAGGG + Intergenic
1087830398 11:102813658-102813680 TGCCCCACCCAGATGGTAACAGG - Intergenic
1087839517 11:102907456-102907478 GGTCCCACACAGATGGGACGCGG + Intergenic
1087924717 11:103906462-103906484 GTGTCCACCCAGATGGGAAAAGG + Intergenic
1089232737 11:116993878-116993900 TGTGCCACACAGTTCGGAAAAGG - Intronic
1089389227 11:118088677-118088699 TGGCCCAAACAGAAAGGGAAAGG + Intronic
1089604707 11:119635203-119635225 TGGCCCACACAGAGGGGCCTTGG + Intronic
1089633553 11:119797940-119797962 GGGCCAACACAGCTGAGAAAAGG - Intergenic
1089781219 11:120874533-120874555 AGCTCCACACAGCTGGGAAAGGG + Intronic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090908060 11:131094657-131094679 GGGCCCACACAGAAGCCAAATGG - Intergenic
1092626725 12:10336306-10336328 TGTCCTACACAGATGGGACGTGG + Intergenic
1092723698 12:11465547-11465569 GGTCCCACACAGATGGGACGCGG + Intronic
1092739301 12:11613072-11613094 GGTCCCGCACAGATGGGACATGG + Intergenic
1092789730 12:12060727-12060749 GGTCCCGCACAGATGGGACACGG - Intronic
1093024355 12:14232914-14232936 GGTCCCGCACAGATGGGACACGG - Intergenic
1093071141 12:14708251-14708273 GGTCCCACACAGATGGGACGCGG + Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093321963 12:17723652-17723674 GGTCCCACACAGATGGGACGTGG + Intergenic
1093343929 12:18016814-18016836 TATCCCACACAGATGAGAAAGGG + Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1093915234 12:24794929-24794951 TGGACTACCCAGATGTGAAATGG - Intergenic
1094316028 12:29138379-29138401 GGTCCCACACAGATGGGTCATGG + Intergenic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095703857 12:45216932-45216954 TGGGCTCCGCAGATGGGAAAGGG - Intronic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1095999002 12:48113508-48113530 GGTCCCGCACAGATGGGACATGG + Intronic
1096379781 12:51146432-51146454 TGGCCCACAAACATATGAAAAGG + Intronic
1097242278 12:57583690-57583712 TGGCATATACAGATGGGAAGAGG - Intronic
1097316119 12:58173152-58173174 TGTCTCACACAGATGTGCAAAGG + Intergenic
1097398611 12:59104174-59104196 TGTCCCGCACAGATGGGACACGG - Intergenic
1097417031 12:59326596-59326618 GGTCCCACACAGATGGGACGTGG + Intergenic
1097542177 12:60955360-60955382 GGTCCCACACAGATGGGACGTGG + Intergenic
1098173618 12:67770025-67770047 GGTCCTACACAGATGGGACACGG + Intergenic
1098402274 12:70087735-70087757 GGTCCCACACAGATGGGACGCGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099292080 12:80786455-80786477 GGTCCCACACAGATGGGACGCGG + Intergenic
1099762609 12:86941134-86941156 GGTCCCACACAGATGGGACGCGG - Intergenic
1100031054 12:90191625-90191647 GGGCCCACACATATAGGAGAGGG - Intergenic
1100561382 12:95751511-95751533 GGTCCCACACAGATGGGATGCGG - Intronic
1100940321 12:99717522-99717544 GGTCCCACACAGATGGGACGCGG - Intronic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1101278375 12:103226057-103226079 GGTCCCACACAGATGGGACGTGG + Intergenic
1102550510 12:113688393-113688415 TGGCCCAAGCATAGGGGAAAGGG - Intergenic
1102688553 12:114742610-114742632 GGACCCACACAGATGGGGCAGGG + Intergenic
1102941145 12:116943230-116943252 GGGCCCATACACAGGGGAAAAGG - Intronic
1102964954 12:117118803-117118825 TGCCCCCCACTGCTGGGAAAGGG + Intergenic
1103701342 12:122850266-122850288 TGGCCCACATAGGTGGCAGAGGG - Intronic
1104197827 12:126558145-126558167 CGGCCCACACAGGTGGGAGCTGG + Intergenic
1105675992 13:22672191-22672213 TGGCACGCACAGCTGGGCAATGG - Intergenic
1106943463 13:34800978-34801000 GGTCCCGCACAGATGGGACACGG - Intergenic
1107075602 13:36318777-36318799 GGTCCCACACAGATGGGACGGGG - Intronic
1107220274 13:37972553-37972575 GGTCCCACACAGATGAGACACGG + Intergenic
1107232506 13:38127356-38127378 GGACCCACACAGGTGGGGAAAGG + Intergenic
1107275608 13:38675238-38675260 AGGCCCACTCACATGGGAGAGGG - Intergenic
1107683118 13:42870795-42870817 GGTCCCACACAGATAGGACACGG + Intergenic
1107861768 13:44667619-44667641 TGGCTCTCACAGATGGGGCAGGG + Intergenic
1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG + Intergenic
1108513017 13:51172202-51172224 GGTCCCACACAGATGGGACGCGG - Intergenic
1108913397 13:55581622-55581644 GGTCCCACACAGATGGGACGCGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1108947457 13:56042646-56042668 GGTCCCACACAGATGGGACGTGG - Intergenic
1109322090 13:60823465-60823487 TGGCCCATATAAATTGGAAAAGG + Intergenic
1109574418 13:64234478-64234500 TGGCCGACACATATGTGAAAAGG + Intergenic
1109716719 13:66229758-66229780 GGTCCCACACAGATGGGACGTGG + Intergenic
1110745995 13:79053985-79054007 TTGCCCAAACAGATTGGAGAAGG - Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111302070 13:86360741-86360763 GGTCCCACACAGATGGGACGCGG - Intergenic
1111362084 13:87189804-87189826 GGTCCCACACAGATGGGATATGG + Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111630465 13:90841775-90841797 GGTCCCACACAGATGGGACGTGG - Intergenic
1111707418 13:91767810-91767832 TGTGCCAAACAGATGGGAAAAGG - Intronic
1111744033 13:92243246-92243268 TGATCCAAACAGAAGGGAAAGGG - Intronic
1112236853 13:97644651-97644673 GGTCCCACACAGATGGGATGCGG - Intergenic
1112492536 13:99880473-99880495 TGGATCACACAGCTAGGAAAAGG + Intronic
1112768396 13:102771522-102771544 TCACACACACAGATGGGGAAAGG - Intronic
1113147056 13:107218759-107218781 TGTCACACAAAGATGGGGAATGG + Intronic
1113321664 13:109238422-109238444 TAGCCAGCACAGATGGGTAAGGG + Intergenic
1113324359 13:109267683-109267705 GGTCCCGCACAGATGGGACATGG - Intergenic
1113793647 13:113044068-113044090 TGGCCCCCACAGCTGTGAAATGG + Intronic
1113897367 13:113774419-113774441 GGTCCCACAGGGATGGGAAAGGG + Intronic
1114221699 14:20702918-20702940 GGTCCCGCACAGATGGGACATGG - Intergenic
1114403936 14:22436372-22436394 TGGCCCAGACAGATGAGGATGGG - Intergenic
1115240582 14:31248720-31248742 GGTCCCGCACAGATGGGACACGG + Intergenic
1115410345 14:33067114-33067136 TGGGCCACACAGACCGGAGAGGG - Intronic
1116179702 14:41518278-41518300 GGTCCCACACAGATGGGACGCGG - Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1116702383 14:48258759-48258781 GGTCCCGCACAGATGGGACACGG + Intergenic
1118736719 14:68706149-68706171 CGGCCCAGACAGGTTGGAAATGG - Intronic
1119114285 14:72004107-72004129 TGGGCAACACAGATTGGGAATGG + Intronic
1119391822 14:74296074-74296096 TGGGCCACTCAGATTGGACAGGG - Intronic
1119682038 14:76599673-76599695 TCTCCAAAACAGATGGGAAAGGG + Intergenic
1119851543 14:77870015-77870037 GGACCAACACAGATGGGTAAAGG + Intronic
1121999885 14:98638385-98638407 TAGCCCACACACAGGGGAAAGGG + Intergenic
1122041019 14:98987534-98987556 GGTCCCACACAGATGGGACGCGG - Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1122434774 14:101687947-101687969 TTGCCCACACATAGGGGAAGCGG + Intergenic
1122813896 14:104302926-104302948 TGGCCCACATAGATGACAACCGG - Intergenic
1125045798 15:35241105-35241127 GGTCCCGCACAGATGGGACACGG - Intronic
1125213194 15:37239572-37239594 GGTCCCACACAGATGGGACGCGG + Intergenic
1126530130 15:49702513-49702535 GGTCCCACACAGATGGGATGTGG + Intergenic
1126912383 15:53430209-53430231 GGTCCCGCACAGATGGGACATGG + Intergenic
1127622126 15:60744510-60744532 TGGGCCACACAGCTGGTAAGAGG - Intronic
1128182911 15:65620815-65620837 TGGCCCAGAAAGATGAAAAAAGG - Intronic
1128237623 15:66078689-66078711 AGCCCCACACAGGTGTGAAAAGG - Intronic
1128407809 15:67361102-67361124 AGGCCCACTCAGTTGGTAAAAGG + Intronic
1128565574 15:68698658-68698680 TTGGCCACCCAGATGGTAAATGG - Intronic
1128721511 15:69954008-69954030 GGGGTCACACAGATAGGAAATGG + Intergenic
1129001620 15:72340027-72340049 AGGCAGACACAGATGGGAAGGGG - Intronic
1129072725 15:72964398-72964420 TGGGCCATATAGATGGAAAAGGG + Intergenic
1129326677 15:74803494-74803516 AGGCCTGCACAGATGGGAACGGG + Intergenic
1129535497 15:76311047-76311069 TGACCGACAAAGGTGGGAAACGG + Intronic
1130040209 15:80400037-80400059 TGTCCCACAGAGATAGGAAGGGG - Intronic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1130440314 15:83946314-83946336 GGGCCCACATAGATGTGCAATGG - Intronic
1130585894 15:85182054-85182076 TGGCCCAGCCAGGTTGGAAAAGG + Intergenic
1130992366 15:88883371-88883393 TGGATTACACAGCTGGGAAAAGG - Intronic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1131274942 15:90973073-90973095 TGTCCTGCAGAGATGGGAAAGGG - Intronic
1131882493 15:96875201-96875223 GGTCCCACACAGATGGGACGTGG + Intergenic
1132340435 15:101074872-101074894 GGTCCCGCACAGATGGGACACGG - Intronic
1132855755 16:2043918-2043940 TGGCCCACACGGGTGGGAGGAGG - Intronic
1133766742 16:8843456-8843478 GGTCCCGCACAGATGGGACACGG + Intronic
1133818497 16:9215960-9215982 AGGGCCACACAACTGGGAAATGG - Intergenic
1133869521 16:9674490-9674512 GGTCCCACACAGATGGGACGTGG + Intronic
1134400395 16:13904567-13904589 TGCACCAAACAAATGGGAAAAGG + Intergenic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1136529975 16:30861492-30861514 GATCCCACACAGATGGGACACGG - Intronic
1138759078 16:59521005-59521027 GGTCCCGCACAGATGGGACACGG + Intergenic
1139225892 16:65233209-65233231 GGTCCCACACAGATGGGACGCGG + Intergenic
1139230576 16:65278626-65278648 GGTCCCACACAGATGGGACGCGG + Intergenic
1139943028 16:70619841-70619863 GGTCCCACACAGATGGGACGCGG + Intronic
1139943696 16:70624158-70624180 GGTCCCACACAGATGGGACGCGG + Intronic
1141784218 16:86187721-86187743 TGGGCTCCACAGATGGGAGAAGG + Intergenic
1141865183 16:86745398-86745420 GGTCCCGCACAGATGGGACACGG + Intergenic
1142137614 16:88458841-88458863 TGGCCCAGACTGAAGGGAAGGGG + Intronic
1142448887 16:90162074-90162096 AGACCCACACAGATGGGATTTGG + Intergenic
1142449289 16:90165493-90165515 AGACCCACACAGATGGGATTTGG + Intergenic
1142975729 17:3642945-3642967 TTGCCCACACAGCTTGAAAATGG - Intronic
1143159227 17:4858221-4858243 AGGCCCACACAGAGAGGAAGAGG - Intronic
1143282507 17:5765380-5765402 TGACCCAAACAGATGGAAACAGG - Intergenic
1145080643 17:19891836-19891858 GGTCCCACACAGATGGGACGTGG + Intergenic
1146597921 17:34185610-34185632 GGTCCCACACAGATGGGACGCGG - Intergenic
1147166190 17:38594732-38594754 AGGCTCACACAGCTAGGAAATGG + Intronic
1147546128 17:41403028-41403050 AGGCCCTCACAGTTGGGAACAGG + Intergenic
1148025415 17:44584264-44584286 TTTCCCACACAGAAGGGAACAGG - Intergenic
1149220527 17:54411793-54411815 GGTCCCTCACAGATGGGACATGG - Intergenic
1149474906 17:56952527-56952549 AGGCCCACCCACATTGGAAACGG - Intronic
1150939314 17:69673137-69673159 TGGCCCAGACAGATGGTTAGTGG + Intergenic
1151839732 17:76609328-76609350 GGTCCCGCACAGATGGGACACGG + Intergenic
1152558420 17:81066116-81066138 AGGCCTCCAGAGATGGGAAAGGG - Intronic
1153250355 18:3115745-3115767 TGGCCAACAGAGTTAGGAAATGG + Intronic
1153684105 18:7528216-7528238 TGGGCCACCCAGATGGGAGCTGG - Intergenic
1155696995 18:28696474-28696496 GGTCCCGCACAGATGGGACACGG + Intergenic
1155917804 18:31573182-31573204 TGCCCAACACACTTGGGAAATGG - Intergenic
1155941572 18:31806141-31806163 GGTCCCACACAGATGGGATGTGG - Intergenic
1156251909 18:35359682-35359704 GGTCCCGCACAGATGGGATATGG + Intergenic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1156841268 18:41612496-41612518 TGGCCTACACATATGGCAAGAGG + Intergenic
1158017696 18:52804076-52804098 TGGCCCACACACATTGTACAGGG - Intronic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1159164487 18:64683977-64683999 GGTCCCGCACAGATGGGACATGG - Intergenic
1159835075 18:73326973-73326995 GGTCCCACACAGATGGGACGCGG - Intergenic
1160750403 19:731388-731410 CGGCTCACACAGCTGGGAAGTGG - Intronic
1161661743 19:5550807-5550829 GGTCCCACACAGATGGGACGCGG - Intergenic
1161777775 19:6273134-6273156 TGGCTGACAGATATGGGAAACGG + Intronic
1162827575 19:13263070-13263092 AGGCCCAGCCAGATGGCAAAGGG - Intronic
1163487312 19:17595765-17595787 GGTCCCACACAGATGGGATACGG - Intergenic
1163817909 19:19478231-19478253 TGGGGCCCACAGATGGAAAAGGG - Intronic
1163944431 19:20522454-20522476 GGTCCCGCACAGATGGGACATGG + Intergenic
1164080827 19:21860138-21860160 GGTCCCACACAGATGAGACAGGG - Intergenic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164459204 19:28433236-28433258 GGTCCCCCACAGATGGGACATGG + Intergenic
1164897176 19:31886941-31886963 TGGCCCAAAGAAATGGGAGAAGG - Intergenic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1165535692 19:36442567-36442589 TGGCCAACAGATATGTGAAAAGG - Intergenic
1165587574 19:36932795-36932817 TGGCCAACAAACATAGGAAATGG - Intronic
1166368229 19:42287829-42287851 AGGCCCACCCAGATTGGAAGTGG + Exonic
1166498917 19:43326876-43326898 GGTCCCACACAGATGGGACGCGG + Intergenic
1166604809 19:44131621-44131643 TGGTCCACACAGGAGAGAAACGG + Exonic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1167046579 19:47053120-47053142 GGTCCCACACAGATGGGACGCGG + Intergenic
1167511777 19:49898973-49898995 TGGGGCACAGAGAGGGGAAAAGG + Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168051664 19:53833946-53833968 GGTCCCACACAGATGGGACGCGG - Intergenic
1168227965 19:55010157-55010179 GGTCCCGCACAGATGGGACACGG + Intergenic
1168471896 19:56646803-56646825 TGGCCCAAACAGATGGATAAAGG + Intronic
925297775 2:2789610-2789632 TGGTGCTCACAGGTGGGAAAGGG + Intergenic
925361738 2:3284787-3284809 AGGAGCACACAGTTGGGAAAGGG + Intronic
925393509 2:3515839-3515861 TGGCCGACACTTATGGAAAATGG + Intronic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
925828797 2:7876035-7876057 GGTCCCACACAGATGGGACTCGG + Intergenic
926815525 2:16795315-16795337 GGTCCCACACAGATGGGACGTGG + Intergenic
927109299 2:19852761-19852783 TGGCCCACACTGAAGAAAAATGG + Intergenic
928770199 2:34696189-34696211 GGTCCCGCACAGATGGGACACGG - Intergenic
928857193 2:35815417-35815439 GGTCCCGCACAGATGGGACATGG - Intergenic
928928586 2:36601372-36601394 GGTCCCGCACAGATGGGACACGG - Intronic
928931211 2:36626220-36626242 TGAGCTACAGAGATGGGAAAAGG + Intronic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929643286 2:43603214-43603236 TGGCCCAAGCAGCTGGGAAGAGG - Intergenic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
929793043 2:45037809-45037831 GGTCCCGCACAGATGGGACATGG + Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931026371 2:58116789-58116811 GGTCCCGCACAGATGGGACACGG + Intronic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
931771800 2:65503786-65503808 TCGCCCACAGAGAAGGGAAGGGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932358798 2:71088417-71088439 GGTCCCGCACAGATGGGACACGG + Intergenic
932973934 2:76577227-76577249 GGTCCCACACAGATGGGACGCGG + Intergenic
933079290 2:77967446-77967468 GGTCCCGCACAGATGGGACATGG - Intergenic
933137956 2:78760234-78760256 GGTCCCTCACAGATGGGACATGG - Intergenic
933220243 2:79679572-79679594 AGGACCACAGAGATGGGAAAGGG - Intronic
933317573 2:80734159-80734181 TGGCAAACACACATAGGAAAAGG + Intergenic
933552371 2:83792283-83792305 GGTCCCGCACAGATGGGACACGG + Intergenic
934227957 2:90150288-90150310 GGTCCCGCACAGATGGGACACGG + Intergenic
935619469 2:105116481-105116503 TGGGACACACACATCGGAAATGG - Intergenic
936794270 2:116187642-116187664 GGTCCCACACAGATGGGATGGGG + Intergenic
936883357 2:117281078-117281100 GGTCCCACACAGATGGGACGCGG - Intergenic
938157150 2:128951556-128951578 TGGCCCACAGAGGAAGGAAAGGG - Intergenic
938601018 2:132838974-132838996 TGGCCCACAAACATGTCAAAAGG - Intronic
939307436 2:140428476-140428498 GGTCCCGCACAGATGGGAAGCGG - Intronic
939460716 2:142493212-142493234 GGACCCATACAGATGGGACATGG + Intergenic
939952469 2:148491050-148491072 TGGCACACACAGCTGGGAAGGGG + Intronic
940182962 2:150955376-150955398 GGTCCCACACCGATGGGACATGG - Intergenic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
940255959 2:151729517-151729539 AGGGCCACAAAGATGGCAAAAGG - Intronic
940508767 2:154586611-154586633 GGTCCCGCACAGATGGGACATGG + Intergenic
940530209 2:154869658-154869680 GGTCCCGCACAGATGGGACACGG - Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
941340421 2:164298192-164298214 GGTCCCGCACAGATGGGACACGG - Intergenic
941359784 2:164537765-164537787 TGGCACGCACAGACCGGAAATGG - Intronic
943412910 2:187563852-187563874 GGTCCCACACAGTTGGGACACGG + Intronic
943421564 2:187673851-187673873 GGTCCCGCACAGATGGGACATGG + Intergenic
943835423 2:192509817-192509839 GGTCCTACACAGATGGGACATGG - Intergenic
944394162 2:199249262-199249284 GGTCCCACACAGATGGGACGCGG - Intergenic
944475422 2:200099251-200099273 TAGCCCACACACAAGGGAAGGGG - Intergenic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945376123 2:209080408-209080430 GGTCCCACACAGATGGGACGCGG - Intergenic
945394325 2:209301560-209301582 GGTCCCACACAGATGGGACGCGG - Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
945938342 2:215924708-215924730 GGTCCCACACAGATGGGACGTGG - Intergenic
946000462 2:216477847-216477869 TGACCCACACACATTGCAAAGGG - Intronic
946085637 2:217168526-217168548 TCTCCCACAGAGATGGGAAGGGG - Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
946871735 2:224091224-224091246 GGTCCCGCACAGATGGGACATGG + Intergenic
947858186 2:233338653-233338675 CTGCCCAAACAGAAGGGAAAAGG - Intronic
948013299 2:234667687-234667709 AAGCTCACACAGCTGGGAAATGG + Intergenic
948126996 2:235571479-235571501 TGGACCACACAGATAGTGAAAGG + Intronic
948180118 2:235972942-235972964 TGTCGCACACAGCTGGGGAAGGG - Intronic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1170106256 20:12756209-12756231 GGTCCCACACAGATGGGACGCGG - Intergenic
1170165763 20:13359298-13359320 GGTCCCACACAGATGGGATGCGG - Intergenic
1170581206 20:17700889-17700911 TGGCACTCACAGATGGTGAATGG - Intronic
1170680413 20:18520971-18520993 GGTCCCGCACAGATGGGACACGG + Intronic
1170820681 20:19754519-19754541 GGTCCCGCACAGATGGGACACGG + Intergenic
1171325894 20:24292343-24292365 TGGCCAACAAACATGGAAAAAGG - Intergenic
1171989486 20:31684736-31684758 AGCCCCTCAAAGATGGGAAATGG - Intronic
1172512918 20:35513042-35513064 TGCACCACACAGAGTGGAAATGG + Exonic
1172843611 20:37916383-37916405 TGGCCCAGACATGTGGGAAGAGG + Intronic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173859736 20:46275323-46275345 AGGCCCACAGATATGGGGAAAGG - Intronic
1174477099 20:50803216-50803238 TGGCCCGCACTGATGGGCACTGG - Intronic
1175277444 20:57781908-57781930 TGGGGGACACAGATGAGAAAGGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176877534 21:14147966-14147988 TGGCCCAGACATATGAGTAATGG - Intronic
1177100646 21:16894513-16894535 GATCCCACACAGATGGGACATGG - Intergenic
1177102696 21:16916325-16916347 GGTCCCGCACAGATGGGACATGG - Intergenic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1178793524 21:35722233-35722255 AGGCTAACACAGATGGGATAAGG - Intronic
1178924993 21:36767343-36767365 TGGCTCACACAGGAGGGACAGGG + Intronic
1179387579 21:40957287-40957309 GGTCCCACACAGATGGGACGTGG - Intergenic
1179914142 21:44465311-44465333 TGTCCCTCCCAGATGGGACAGGG + Intergenic
1180715243 22:17867390-17867412 TGGCTTATTCAGATGGGAAAAGG - Intronic
1182093019 22:27608943-27608965 GAGCCCACACAGATGAGAGATGG + Intergenic
1182459776 22:30475425-30475447 TAGACCACACAGATGTGAAGTGG + Intergenic
1182572994 22:31252873-31252895 TGGGTGACACAGATGGTAAATGG + Intronic
1182779381 22:32855502-32855524 AAGGCCACACAGTTGGGAAATGG - Intronic
1183003709 22:34882768-34882790 AAGGCCACACAGCTGGGAAAGGG + Intergenic
1184883517 22:47327591-47327613 TCGCCCACACACATTGGAGAGGG + Intergenic
949399769 3:3653826-3653848 TGGTCCCCACAGAAGGGTAAGGG + Intergenic
949671175 3:6400016-6400038 GGTGCCACACAGATGGGATATGG - Intergenic
950107359 3:10396734-10396756 TAGCCCAGAGAGGTGGGAAAGGG + Intronic
951332306 3:21381936-21381958 GGTCCCGCACAGATGGGACATGG + Intergenic
952076551 3:29703800-29703822 TGGGCCACACAGGTAGGAACTGG + Intronic
952663434 3:35877698-35877720 GGTCCCGCACAGATGGGACATGG + Intergenic
952896036 3:38079653-38079675 GGTCCCACACAGATGGGACGTGG + Intronic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
953698689 3:45179559-45179581 GGGACCACACAGCTGTGAAAGGG + Intergenic
954284748 3:49610976-49610998 TAGCCCACAAAGATGGCTAAGGG - Intronic
954422012 3:50423825-50423847 TGGCCCTCAGAGATGGGAGGTGG + Intronic
954846746 3:53566050-53566072 TTGGCCACCCAGATTGGAAAAGG - Intronic
954969244 3:54637856-54637878 GGTCCCACACAGATGGGACGCGG + Intronic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
956714805 3:72069563-72069585 TGACTGTCACAGATGGGAAAGGG - Intergenic
956742348 3:72285099-72285121 GGGGCCACCCAGTTGGGAAATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
957734847 3:84191175-84191197 GGTCCCACACAGAAGGGACAAGG + Intergenic
957985709 3:87571693-87571715 GGTCCCGCACAGATGGGACATGG - Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
959288331 3:104443292-104443314 GGTCCCACACAGATGGGACGCGG + Intergenic
959972245 3:112420938-112420960 GGTCCCACACAGATGGGACGCGG + Intergenic
960282854 3:115796879-115796901 GGTCCCACACAGATGGGACGTGG + Intergenic
960369664 3:116818167-116818189 AGGCAGACACAGATGAGAAAGGG - Intronic
961164740 3:124755926-124755948 GGTCCCACACAGATGGGACGCGG + Intergenic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961639913 3:128358624-128358646 AGGCCCCCTCAGATGGTAAATGG - Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
961730607 3:128962042-128962064 GGTCCCGCACAGATGGGACACGG - Intronic
961893694 3:130150513-130150535 GGTCCCACACATATGGGACATGG + Intergenic
962205586 3:133431465-133431487 GGTCCCGCACAGATGGGACACGG - Intronic
962763350 3:138538643-138538665 TGACCCCCACAGATGGAAAAAGG + Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
963058644 3:141207300-141207322 GGTCCCGCACAGATGGGACATGG - Intergenic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963425240 3:145115316-145115338 GGTCCCACACAGATGGGATAAGG - Intergenic
963468632 3:145712734-145712756 GGTCCCACACAGATGGGATAAGG - Intergenic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
963684352 3:148416684-148416706 GGTCCCACACAGATGGGACGTGG - Intergenic
964300233 3:155278556-155278578 GGTCCTACACAGATGGGACATGG + Intergenic
965624862 3:170675896-170675918 GGTCCCGCACAGATGGGACATGG + Intronic
965640019 3:170821332-170821354 GGTCCCGCACAGATGGGACATGG + Intronic
966085450 3:176063671-176063693 GGTCCCGCACAGATGGGACATGG - Intergenic
966105067 3:176324997-176325019 AGTCCTACACAGATGGGACACGG + Intergenic
966279324 3:178209868-178209890 GGTCCCACAGAGATGGGACAAGG - Intergenic
966397674 3:179519198-179519220 GGTCCCACACAGATGGCACATGG - Intergenic
966398429 3:179524307-179524329 GGTCCCACACAGATGGCACATGG + Intergenic
967005338 3:185377906-185377928 GGTCCCGCACAGATGGGACATGG + Intronic
967152147 3:186660351-186660373 AGTCCTACACAGATGGGATACGG - Intronic
967212146 3:187178903-187178925 GGTCCCACACAGATGGGACGCGG + Intronic
967624632 3:191669862-191669884 GGTCCCGCACAGATGGGACACGG + Intergenic
968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG + Intronic
969464281 4:7345619-7345641 TGCATCTCACAGATGGGAAACGG - Intronic
969491657 4:7502620-7502642 TGTCCCAGACAGACGGGAAGTGG - Intronic
969749076 4:9096595-9096617 GGTCCCGCACAGATGGGACATGG - Intergenic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
971180581 4:24325546-24325568 GGTCCCGCACAGATGGGACAAGG - Intergenic
971200156 4:24503343-24503365 CGTCCCGCACAGATGGGACACGG - Intergenic
972460622 4:39298925-39298947 TGGCCAACACTGTTGGGAACAGG + Intronic
973162229 4:47032515-47032537 CGGCTTACGCAGATGGGAAATGG + Intronic
974428377 4:61767666-61767688 GGTCCCACACAGATGGGACGTGG + Intronic
974999225 4:69199170-69199192 TGGCCAACACTTATGGAAAATGG + Intronic
975006559 4:69296074-69296096 TGGCCAACACTTATGGAAAATGG - Intronic
975844663 4:78512146-78512168 TGGGCCACCATGATGGGAAATGG + Intronic
975865072 4:78717236-78717258 GGTCCCACACAGATGGGATGCGG + Intergenic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
976884552 4:89968170-89968192 GGTCCCACACAGATGGGATGTGG + Intergenic
977012905 4:91658000-91658022 GGTCCCACAGAGATGGGAAGCGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
977075185 4:92442339-92442361 GGTCCTACACAGATGGGACACGG + Intronic
977198411 4:94088002-94088024 GGTCCCGCACAGATGGGACACGG + Intergenic
977225325 4:94386846-94386868 GGTCCCGCACAGATGGGACATGG + Intergenic
977465339 4:97377314-97377336 GGGCCCACACAGCTAGTAAATGG - Intronic
978001100 4:103557141-103557163 GGTCCCACACAGATGGGACGTGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979850290 4:125565014-125565036 GGTCCCACACAGATGGGACGCGG + Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981116044 4:140992659-140992681 TGGCCCTCCCTGATGGGTAAGGG + Intronic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
982318827 4:154058613-154058635 GGTCCCACAAAGATGGGACATGG - Intergenic
982497089 4:156106844-156106866 GGTCCCGCACAGATGGGACACGG + Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
982658882 4:158182685-158182707 TGACCAACACAGAGGGAAAAGGG + Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983055507 4:163095421-163095443 GGTCCCGCACAGATGGGACACGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
983360425 4:166718633-166718655 GGTCCCACACAGATGGGACGCGG - Intergenic
983448075 4:167878584-167878606 GGTCCCGCACAGATGGGACACGG - Intergenic
983452353 4:167925227-167925249 GGTCCCACACAGATGGGACGTGG - Intergenic
983952969 4:173663533-173663555 TGGGCCAGACAGAAGAGAAATGG + Intergenic
984322208 4:178209455-178209477 GGTCCCATACAGATGGGACATGG - Intergenic
984393596 4:179168267-179168289 GGTCCCGCACAGATGGGACACGG + Intergenic
984437282 4:179722779-179722801 GGTCCCACACAGATGGGACGTGG - Intergenic
984700690 4:182816855-182816877 GGTCCCGCACAGATGGGACACGG - Intergenic
986193553 5:5517888-5517910 GGTCCCGCACAGATGGGACATGG - Intergenic
986388898 5:7265918-7265940 GGTCCCACACAGATGGGACGCGG - Intergenic
986905791 5:12492134-12492156 GGTCCCGCACAGATGGGACACGG - Intergenic
986989242 5:13532303-13532325 TGGCAAACACCGATGGGATAAGG + Intergenic
987486858 5:18536008-18536030 GGTCCCACACAGATGGGATGCGG - Intergenic
987498102 5:18672236-18672258 GGTCCCACACAGATGGGACGCGG + Intergenic
988199116 5:28047972-28047994 GGTCCCGCACAGATGGGACATGG - Intergenic
988369889 5:30354883-30354905 TGGCCCACACTCAAGGGAAAGGG - Intergenic
989106042 5:37864067-37864089 TGAAACACACAGTTGGGAAAAGG - Intergenic
989659945 5:43788447-43788469 GATCCCACACAGATGGGACATGG - Intergenic
989969454 5:50504960-50504982 TGACAAATACAGATGGGAAAAGG - Intergenic
991475328 5:67012359-67012381 TGTCTCACACAGATGGAAACTGG + Intronic
992451984 5:76883761-76883783 GGTCCCGCACAGATGGGACATGG + Intronic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
993192732 5:84700812-84700834 GGTCCCACACAGATGGGACGTGG - Intergenic
994327846 5:98469676-98469698 TGACACAAACAAATGGGAAAAGG + Intergenic
994364612 5:98898859-98898881 TGGCCCACACAGTGGCAAAATGG - Intronic
994532528 5:100987632-100987654 GGTCCCACACAGATGGGACGTGG + Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
994989572 5:106980713-106980735 GGTCCCGCACAGATGGGACACGG - Intergenic
995899349 5:117049742-117049764 GGTCCCGCACAGATGGGACATGG + Intergenic
996344802 5:122476982-122477004 GGTCCCACACAGATGGGATACGG + Intergenic
996511275 5:124318864-124318886 AGGCCCACCCACATTGGAAAGGG + Intergenic
996557758 5:124796634-124796656 TGTCCCACACAGAGAGCAAAAGG - Intergenic
996912424 5:128670598-128670620 GGTCCCGCACAGATGGGACATGG + Intronic
996917701 5:128731879-128731901 GATCCCACACAGATGGGACATGG - Intronic
997678843 5:135735052-135735074 GGTCCCGCACAGATGGGACACGG + Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
998342292 5:141428778-141428800 TGGCCCACACAGAAAGGAACAGG - Intronic
998833459 5:146182778-146182800 AGGCCCACTCAGAGGGGAACCGG + Intergenic
998996380 5:147872350-147872372 GGTCCTACACAGATGGGACACGG + Intronic
999317175 5:150591477-150591499 TGGAGTTCACAGATGGGAAAGGG + Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1000953329 5:167512317-167512339 TGGCCCACACAGCTGTTAATGGG + Intronic
1001331433 5:170765411-170765433 GGTCCCGCACAGATGGGACACGG + Intronic
1001435536 5:171696382-171696404 TAGCCCAGACAGATGGGCACAGG + Intergenic
1002610941 5:180418103-180418125 GGTCCCACACAGATGGGATGCGG + Intergenic
1002728808 5:181319972-181319994 AGACCCACACAGATGGGATTTGG + Intergenic
1003103589 6:3196092-3196114 TGGCCCCCAGGGATGGGGAAGGG + Intergenic
1004106286 6:12669710-12669732 GGTCCCGCACAGATGGGACATGG - Intergenic
1004469971 6:15920430-15920452 GAGACCACACAGAAGGGAAAGGG + Intergenic
1005014638 6:21364885-21364907 GGTCCCACACAGATGGGACGTGG + Intergenic
1005601222 6:27428247-27428269 TTGCCCACACAGATTAGAAGTGG - Intergenic
1006174299 6:32112694-32112716 TGGCCCCCACAGCTGGGAAGAGG + Intronic
1008476547 6:51940516-51940538 GGTCCCACACAGATGGGGCATGG - Intronic
1009379162 6:63007646-63007668 GGTCCCACAGAGATGGGACATGG - Intergenic
1009750286 6:67872343-67872365 GGTCCCACATAGATGGGACATGG + Intergenic
1010071705 6:71751925-71751947 GGTCCCGCACAGATGGGACACGG + Intergenic
1010586677 6:77663933-77663955 GGTCCCACACAGATGGGACGCGG + Intergenic
1010662332 6:78585727-78585749 GGTCCCGCACAGATGGGACACGG - Intergenic
1010826894 6:80485815-80485837 GGTCCCGCACAGATGGGACACGG + Intergenic
1010841294 6:80651175-80651197 GGTCCCGCACAGATGGGACATGG + Intergenic
1010894527 6:81348515-81348537 GGTCCCGCACAGATGGGACACGG + Intergenic
1011367880 6:86601748-86601770 GGTCCCGCACAGATGGGACATGG + Intergenic
1011379245 6:86724880-86724902 TGCCCCACACAGCTGGGATGGGG + Intergenic
1011770922 6:90673590-90673612 GGTCCCACACAGATGGGACGTGG + Intergenic
1011894003 6:92201280-92201302 TGAGCCACTGAGATGGGAAAAGG - Intergenic
1011947957 6:92930884-92930906 TGGCCAGCACAGACGAGAAATGG - Intergenic
1012066524 6:94557322-94557344 GGTCCCACACAGATGGGACGCGG + Intergenic
1012250586 6:96975942-96975964 TGGCCCACAGGGCTGGGAAAAGG + Intronic
1012315844 6:97781931-97781953 GGTCCCACACAGATGGGACGCGG - Intergenic
1013353624 6:109328200-109328222 TGGCTGACACAGATGGGATGAGG - Intergenic
1013808066 6:114015690-114015712 GGTCCCACACAGATGGGATGTGG + Intergenic
1013891725 6:115034213-115034235 GGTCCCACACAGATGGGATGCGG - Intergenic
1014360140 6:120465644-120465666 GGTCCCACACAGATGGGACGTGG + Intergenic
1014555868 6:122842161-122842183 GGTCCCACACAGATGGGACGCGG - Intergenic
1014718916 6:124894369-124894391 GGTCCCACACAGATGGGATGTGG - Intergenic
1014733389 6:125061474-125061496 TGTCCCACATAAATGGGCAAAGG - Intronic
1014793970 6:125705239-125705261 GGTCCCACACAGATGGGATGCGG + Intergenic
1014891562 6:126851086-126851108 GGTCCCGCACAGATGGGACATGG - Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1015323850 6:131904018-131904040 GGTCCCACACAGATGGGACGCGG - Intergenic
1016114122 6:140260788-140260810 GGTCCCACACAGATGGGACGTGG + Intergenic
1016248882 6:142018140-142018162 GGTCCCACACAGATGGGATGCGG - Intergenic
1016518826 6:144925504-144925526 GGTCCCACACAGATGGGACGTGG - Intergenic
1016535741 6:145106527-145106549 GGTCCCACACAGATGGGACGCGG + Intergenic
1016650273 6:146453793-146453815 GGTCCCGCACAGATGGGACATGG + Intergenic
1017096845 6:150812279-150812301 TGGCCCACAAAAATGTGCAAAGG + Intronic
1017389522 6:153923817-153923839 GGTCCCACACAGATGGGACGCGG - Intergenic
1018084476 6:160289949-160289971 GGTCCCACACAGATGGGAAGCGG + Intergenic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1018495384 6:164342111-164342133 TGTCCCGCACAGATGGGACTCGG + Intergenic
1019466718 7:1193710-1193732 CGGCCCACACAGCTGGGGAGCGG - Intergenic
1019745798 7:2699886-2699908 GGGCCCCCACAGAAGGGCAAGGG - Intronic
1021393644 7:20122935-20122957 GGTCCCACACAGATGGGACGTGG - Intergenic
1021637335 7:22705576-22705598 GGTCCCGCACAGATGGGACACGG - Intergenic
1021810680 7:24398609-24398631 GGTCCCGCACAGATGGGACATGG - Intergenic
1021977877 7:26027565-26027587 GGTCCCGCACAGATGGGACATGG + Intergenic
1022372891 7:29787179-29787201 GGTCCCGCACAGATGGGACACGG - Intergenic
1022484875 7:30770765-30770787 AGGCCCACACAGCTGGGTACTGG - Intronic
1022495144 7:30848383-30848405 TGGGCCACACAGCAGGGGAAGGG + Intronic
1022572773 7:31470405-31470427 GGTCCCGCACAGATGGGACATGG + Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1023399488 7:39781593-39781615 AGACCCACACAGATGGGATTTGG + Intergenic
1023698867 7:42873985-42874007 GGTCCCGCACAGATGGGACATGG + Intergenic
1023877383 7:44294333-44294355 TGGCACACACAGGTAGCAAAAGG + Intronic
1024243923 7:47455266-47455288 TGGCCAACTCTGATGGGCAAAGG + Intronic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1024963018 7:54997138-54997160 TGGCCCACTCAGCAGGGGAAAGG - Intergenic
1025055086 7:55758688-55758710 AGACCCACACAGATGGGATTTGG - Intergenic
1025133158 7:56388914-56388936 AGACCCACACAGATGGGATTTGG - Intergenic
1025185948 7:56858527-56858549 GGACCCACACAGATGGGATTTGG - Intergenic
1025685978 7:63718414-63718436 GGACCCACACAGATGGGATTTGG + Intergenic
1025910877 7:65827448-65827470 AGACCCACACAGATGGGATTTGG + Intergenic
1025977459 7:66380076-66380098 AGACCCACACAGATGGGATTTGG - Intronic
1025978873 7:66391681-66391703 GGACCCACACAGATGGGATTTGG - Intronic
1026287184 7:68973619-68973641 GGGCAGACACAGTTGGGAAAGGG - Intergenic
1026969447 7:74459035-74459057 TGGCCCAGAGAGAAGGGAATGGG - Intronic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1027185835 7:75970097-75970119 TAGCCCAGAGAGGTGGGAAATGG + Intronic
1027203141 7:76075213-76075235 AGACCCACACAGATGGGATTTGG - Intergenic
1027471438 7:78579023-78579045 TGAGCCACACAGATGAGACATGG - Intronic
1028670529 7:93396263-93396285 GGTCCCACACAGATGGGTCACGG - Intergenic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1031525610 7:122819253-122819275 GGTCCCACACAGATGGGACGTGG - Intronic
1031727911 7:125262280-125262302 GGTCCCACACAGAAGGGACATGG + Intergenic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1031777365 7:125919946-125919968 GGTCCCACACAGATGGGACTTGG - Intergenic
1031894453 7:127332313-127332335 TAGCCTTCACAGCTGGGAAAAGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1033088577 7:138364882-138364904 GGTCCCGCACAGATGGGACATGG - Intergenic
1033403564 7:141050509-141050531 TGAGCTACAGAGATGGGAAAAGG + Intergenic
1033695905 7:143788839-143788861 GGTCCCACACAGATGGGACGCGG - Intergenic
1034084813 7:148313428-148313450 GGTCCCGCACAGATGGGACATGG + Intronic
1034920795 7:155079802-155079824 TGGACCAAACAGATGGAGAAGGG + Intronic
1035248705 7:157582378-157582400 TGGCCCGCACGTATGTGAAAAGG + Intronic
1036281501 8:7404768-7404790 GGTCCCACACAGATGGGACGCGG - Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1038058718 8:23887508-23887530 TGGCCCACCCATATCGGGAAGGG - Intergenic
1039498983 8:38002055-38002077 GGCCCCGCACAGATGGGACATGG + Intergenic
1041109488 8:54471358-54471380 TGGCCCAGAAAGATGGGACTAGG + Intergenic
1041833642 8:62185583-62185605 TGTACCACACAGAGGGGTAAAGG - Intergenic
1043353651 8:79389483-79389505 GGTCCCACACAGATGGGACGTGG + Intergenic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043598866 8:81915779-81915801 GATCCCACACAGATGGGACATGG - Intergenic
1043698587 8:83253656-83253678 TGGACCATACACAGGGGAAAAGG - Intergenic
1043717879 8:83508519-83508541 GGTCCCGCACAGATGGGACACGG + Intergenic
1044258597 8:90093582-90093604 GGTCCCGCACAGATGGGACATGG + Intronic
1044417102 8:91950300-91950322 GGTCCCGCACAGATGGGACACGG - Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1044925179 8:97203251-97203273 GGTCCCACACAGATGGGACGCGG - Intergenic
1045197543 8:99946202-99946224 GGTCCCACACAGATGGGACGCGG - Intergenic
1045644801 8:104288266-104288288 GGTCCCACACAGATGGGACGCGG - Intergenic
1045673741 8:104586916-104586938 CGGCCCACACTGTTGGAAAAAGG + Intronic
1046386321 8:113512891-113512913 GGTCCCACACAGATGGGACGCGG + Intergenic
1046440032 8:114243669-114243691 GGTCCCACACAGATGGGACGCGG - Intergenic
1046443263 8:114284321-114284343 GGTCCCACACAGATGGGATGCGG - Intergenic
1046512106 8:115214558-115214580 GGTCCCACACAGATGGGACGTGG - Intergenic
1046559297 8:115816940-115816962 GGTCCCGCACAGATGGGATACGG - Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1047829526 8:128615286-128615308 GGTCCCGCACAGATGGGACACGG + Intergenic
1048097628 8:131312537-131312559 GGTCCTACACAGATGGGATACGG - Intergenic
1048122499 8:131597673-131597695 TGGGACACACAGGTGGGAAGAGG - Intergenic
1048150524 8:131889157-131889179 AGGCCCACACAAACTGGAAAGGG - Intergenic
1048168415 8:132083615-132083637 GGTCCCACACAGATGGGACGCGG + Intronic
1048288649 8:133163003-133163025 TGGGCCACGGAGATGGGGAAGGG - Intergenic
1049868799 8:144957637-144957659 GGTCCCGCACAGATGGGACATGG + Intergenic
1050117623 9:2277899-2277921 GGTCCCACACAGATGGGATGCGG - Intergenic
1050258086 9:3814529-3814551 GGTCCCACAAAGATGGGACATGG + Intergenic
1050270728 9:3941646-3941668 TTGCGGACACATATGGGAAAAGG + Intronic
1050402898 9:5275138-5275160 CAGCCCACACAGATGATAAAGGG + Intergenic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1051715376 9:19977604-19977626 TGCCTGACACACATGGGAAAGGG - Intergenic
1051849267 9:21489079-21489101 GGTCCCGCACAGATGGGACACGG + Intergenic
1052163102 9:25290005-25290027 GGTCCCACACAGATGGGACGTGG - Intergenic
1052877521 9:33578508-33578530 TGGCCAAGACAAATGGAAAAAGG - Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1053498468 9:38565700-38565722 TGGCCAAGACAAATGGAAAAAGG + Intronic
1054763871 9:69026640-69026662 TATCCCCCACAGATGGGAGACGG + Intergenic
1054818373 9:69497437-69497459 TGGGCCACACAGAGGGGACCTGG + Intronic
1055233082 9:74087996-74088018 GGTCCCACACAGATGGGACGCGG - Intergenic
1055347697 9:75355158-75355180 GGTCCCGCACAGATGGGACACGG + Intergenic
1055626741 9:78183140-78183162 GGTCCCGCACAGATGGGACACGG - Intergenic
1055810067 9:80139744-80139766 GGTCCCACACAGATGGGACGTGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056363729 9:85883018-85883040 TGTCCCGCACAGATGGGACATGG - Intergenic
1056522466 9:87413259-87413281 GGTCCCACACAGATGGGACGCGG - Intergenic
1056882999 9:90414908-90414930 GGTCCCACACAGATGGGACGTGG - Intergenic
1057234867 9:93349938-93349960 GGTCCCACACAGATGGGACGTGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1057982101 9:99672492-99672514 GGTCCCACATAGATGGGACATGG - Intergenic
1058026188 9:100144071-100144093 GGTCCTACACAGATGGGACACGG + Intronic
1058896856 9:109407901-109407923 AGGCCTACACAGATGACAAAAGG + Intronic
1059606687 9:115842582-115842604 GGTCCCACACAGATGGGACGCGG + Intergenic
1059754794 9:117282446-117282468 TGGCCCACACTAATGGGACAGGG + Intronic
1059863467 9:118489051-118489073 GGTCCCACACAGATGGGACGCGG + Intergenic
1059938570 9:119335898-119335920 TGGCCCATAGAGAAGAGAAAGGG + Intronic
1060425700 9:123503700-123503722 TGGCCTACAGGGGTGGGAAAAGG - Intronic
1060526325 9:124323295-124323317 GGTCCCACAGGGATGGGAAAGGG + Intronic
1060676969 9:125523887-125523909 TGGCCCCCACAGCAGGGAACAGG - Intronic
1060737860 9:126078005-126078027 GGTCCCCCACAGATGGGACACGG + Intergenic
1060915724 9:127389011-127389033 AGGCCCACACTGATGGGAGTGGG - Exonic
1061583090 9:131549419-131549441 GGTCCCGCACAGATGGGACATGG - Intergenic
1203576385 Un_KI270745v1:11850-11872 AGACCCACACAGATGGGATTTGG + Intergenic
1185858410 X:3556501-3556523 GGTCCCGCACAGATGGGACACGG + Intergenic
1185960672 X:4543861-4543883 GGTCCCGCACAGATGGGACACGG + Intergenic
1185991079 X:4893925-4893947 GGTCCCGCACAGATGGGACACGG - Intergenic
1186534068 X:10329208-10329230 TGGACCTCAGAGATGGGAAGTGG + Intergenic
1186784088 X:12942156-12942178 GGTCCCGCACAGATGGGACACGG - Intergenic
1186969991 X:14831580-14831602 CAGCCCACAGAGATGGGGAACGG + Intergenic
1188431044 X:30105677-30105699 GGTCCCACACAGATGGGACGCGG - Intergenic
1189031793 X:37459145-37459167 GGTCCCGCACAGATGGGACATGG + Intronic
1189224392 X:39400476-39400498 TAGTCAACACAAATGGGAAAAGG + Intergenic
1189535178 X:41927890-41927912 AGGCACACAGAAATGGGAAAGGG - Intergenic
1190002720 X:46705146-46705168 TAGCCCACACAGGGGAGAAAGGG + Intronic
1190735510 X:53253375-53253397 AAGGCCACACAGTTGGGAAATGG + Intronic
1192036042 X:67564006-67564028 TGATCCACACAGCTGGCAAATGG + Intronic
1192914114 X:75635642-75635664 GGTCCCACACAAATGGGACATGG + Intergenic
1193537114 X:82729194-82729216 AGTCCCACACAGAAGGGACATGG - Intergenic
1193885947 X:86984139-86984161 GGTCCCGCACAGATGGGACAAGG - Intergenic
1193941519 X:87684223-87684245 GGTCCCACACAGATGGGACGCGG - Intergenic
1194186230 X:90776694-90776716 GGTCCCGCACAGATGGGACACGG + Intergenic
1194293604 X:92103612-92103634 GGTCCCACACAGATGGGACGTGG + Intronic
1194873779 X:99162813-99162835 GGTCCCACACAGATGGGACGTGG + Intergenic
1195016931 X:100789796-100789818 GGTCCCGCACAGATGGGACATGG + Intergenic
1195291135 X:103432905-103432927 GGTCCCATACAGATGGGACACGG + Intergenic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1195908659 X:109868591-109868613 GGTCCCGCACAGATGGGACACGG + Intergenic
1196220963 X:113112094-113112116 GGTCCCGCACAGATGGGACATGG + Intergenic
1196330845 X:114469097-114469119 GGTCCCACACAGATGGGACGCGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1196572517 X:117281493-117281515 GGTCCCGCACAGATGGGACATGG - Intergenic
1196773836 X:119321141-119321163 GGTCCCGCACAGATGGGACATGG + Intergenic
1197244204 X:124151344-124151366 TGAGCTACAGAGATGGGAAAAGG + Intronic
1197352037 X:125392221-125392243 GGTCCCACACAGATGGGATGCGG + Intergenic
1197459614 X:126724144-126724166 TGGCGGACCCAGAAGGGAAATGG - Intergenic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1197933105 X:131714406-131714428 GGTCCCACACAGATGGGATGCGG - Intergenic
1198705339 X:139442953-139442975 TGGCCCACCCAGAAGTGATATGG + Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199517577 X:148695152-148695174 TAGCCCACACAAATGGTAACTGG - Intronic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1199967149 X:152830341-152830363 TTCCACACACAGCTGGGAAAAGG - Intronic
1200532820 Y:4358773-4358795 GGTCCCGCACAGATGGGACATGG + Intergenic
1200611123 Y:5328158-5328180 GGTCCCACACAGATGGGACGTGG + Intronic
1201489245 Y:14523945-14523967 TAACCCACACACACGGGAAAGGG - Intronic