ID: 968327821

View in Genome Browser
Species Human (GRCh38)
Location 3:197835732-197835754
Sequence GGCCGAGGTGAGACAGCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968327819_968327821 -7 Left 968327819 3:197835716-197835738 CCGCAGAGGAAGAGGAGGCCGAG 0: 1
1: 1
2: 5
3: 62
4: 544
Right 968327821 3:197835732-197835754 GGCCGAGGTGAGACAGCCCAAGG 0: 1
1: 0
2: 1
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968327821 Original CRISPR GGCCGAGGTGAGACAGCCCA AGG Exonic
900299257 1:1968955-1968977 GCCCCAGGTGAGACAGCGCCTGG + Intronic
900707765 1:4090984-4091006 GGACCAGGTGAGGCAGGCCATGG - Intergenic
902375270 1:16027443-16027465 GGCCAGGGTCAGGCAGCCCAGGG - Intronic
902380232 1:16049253-16049275 GGCCAGGGTCAGGCAGCCCAGGG - Intronic
902540386 1:17150044-17150066 GGCCAGGGTGAGGCAGCTCAAGG + Intergenic
903277819 1:22232952-22232974 GGCTGAGTAAAGACAGCCCATGG - Intergenic
904639902 1:31918013-31918035 GGCCGAGGTGACAGATCACAAGG + Intronic
905502813 1:38453036-38453058 GGCCGAGGTGAGTGATCACAAGG - Intergenic
906667539 1:47632184-47632206 GGTGGAGGTGAGACACCCCAAGG - Intergenic
913001511 1:114585109-114585131 AGCCCAGGTCAAACAGCCCATGG + Exonic
914442678 1:147720940-147720962 GGCTGAGGGGAGAAAGACCATGG - Intergenic
915318192 1:155041505-155041527 GACTCAGGGGAGACAGCCCAGGG + Exonic
916750986 1:167722379-167722401 GGCCGAGGGGACCCAGCCCATGG + Intronic
916802222 1:168226136-168226158 GTCCGAGGTGAGTGAGCCCGGGG + Exonic
919228271 1:194737635-194737657 GGCCGAGGTGGGAGATCACAAGG - Intergenic
921692474 1:218165687-218165709 GGCCGAGGAGAAACAGCCAGAGG + Intergenic
924391549 1:243565694-243565716 GGCTGAGAAGAGACAGACCAAGG - Intronic
1063191106 10:3695812-3695834 GGCCAAGAAGACACAGCCCATGG + Intergenic
1067537166 10:47121373-47121395 GGCCAAGGTGAGACGTCCTAAGG - Intergenic
1067554074 10:47255605-47255627 TGCTGAGGTGAGGTAGCCCAGGG - Intergenic
1067634365 10:47991507-47991529 GGCCGAGAAGAAACAGCCCCAGG - Intergenic
1075295362 10:121270504-121270526 GGCCAAGGTGACCCAGCACATGG - Intergenic
1075593006 10:123706139-123706161 AGGCAAGGTCAGACAGCCCAGGG + Intergenic
1075635674 10:124028846-124028868 CACCGGGGTGAGCCAGCCCAGGG - Intronic
1077182878 11:1224385-1224407 GGCCCAGGTGGTCCAGCCCAAGG + Intronic
1077268047 11:1661672-1661694 GGCCCAGGTGTGACAACACAGGG + Intergenic
1079387619 11:19994791-19994813 GGCTGAGGAGAGACAGCCCTGGG - Intronic
1082888774 11:58116078-58116100 GCCCGAGGATAGGCAGCCCAGGG + Intronic
1083159761 11:60847852-60847874 GGCCGAGAGGAGACAGGGCATGG + Intronic
1083722880 11:64612063-64612085 GGCCGGGTTGAGTGAGCCCAGGG - Intronic
1083824044 11:65188319-65188341 GGCCGGGGGAAGACAGGCCAGGG + Intronic
1084219472 11:67668311-67668333 GGCAGAGCTGAGACTGCCCCAGG + Intronic
1084643009 11:70437108-70437130 GGCAGGTGTGGGACAGCCCAAGG - Intergenic
1085454693 11:76659177-76659199 GCCTGAGGTGTGAAAGCCCAGGG - Exonic
1090363427 11:126188372-126188394 GGCAGAGGTCAGAAAGCCCAGGG - Intergenic
1091217858 11:133914465-133914487 AGCCCCGGTGAGACAGACCAGGG + Intronic
1091969257 12:4772115-4772137 GGCCAAGTTGAGAAGGCCCACGG + Intronic
1092071057 12:5631738-5631760 GGCCGGGGTGGGACAACACAGGG + Intronic
1094550061 12:31442177-31442199 GGCAGAGGTGAGACATCTGAAGG + Intronic
1094843736 12:34352488-34352510 GGCCCATGGGAGCCAGCCCAAGG - Intergenic
1095913192 12:47449467-47449489 TGCCCTTGTGAGACAGCCCAAGG - Intergenic
1095956652 12:47810415-47810437 GGCTGAGGTGAGACCACCAAGGG + Intronic
1096613327 12:52817247-52817269 GGCTGAGGTGAGGCAGCCGGGGG - Intergenic
1099189923 12:79552027-79552049 GGCAGAGGGGAGAGAGCACATGG + Intergenic
1099390904 12:82077933-82077955 TGCCCACCTGAGACAGCCCATGG + Intergenic
1101904116 12:108812564-108812586 GGCAGGGATGAGACTGCCCATGG + Intronic
1102449038 12:113026800-113026822 GGCCAAGATGAGACAGCCAGAGG - Intergenic
1102576001 12:113856468-113856490 TGCCGAGTTGACACAGCCCTTGG - Intronic
1103568020 12:121826822-121826844 GGGCGGGGGGTGACAGCCCAGGG + Intronic
1103814865 12:123646670-123646692 TGGTGAGGTGAGAGAGCCCATGG + Intronic
1104655022 12:130567932-130567954 GGCATAGGTAAGACAGGCCAAGG - Intronic
1107881566 13:44836782-44836804 GGCTGAGGTGCCAGAGCCCAGGG - Intergenic
1108072301 13:46641023-46641045 GTCAGGGGTGAGTCAGCCCATGG + Intronic
1111251719 13:85609626-85609648 GGATTGGGTGAGACAGCCCATGG - Intergenic
1113608169 13:111624964-111624986 GGTCGAGCTGAGACAGAACATGG + Intronic
1113707063 13:112441847-112441869 GGCAGAGGTGCGTCAGGCCATGG - Intergenic
1117571682 14:57055366-57055388 GACCCAGGTGAGACACCCCTGGG + Intergenic
1117976083 14:61298184-61298206 GGCACAGGTGAGACTGCTCAGGG - Intronic
1119428360 14:74550403-74550425 GGAGGAGGTGGGACAGCCAAGGG - Intronic
1122659757 14:103287455-103287477 GGCAGGGGTGAGGCAGCCCTGGG + Intergenic
1123984128 15:25630080-25630102 GGGGGAGATGAGACAGCCTAGGG + Intergenic
1124360211 15:29031378-29031400 GGCCAAGGAGAGACGGCCCGAGG - Intronic
1128053252 15:64681828-64681850 GGTGGAGGTGAGATAGCCAAGGG - Exonic
1132879005 16:2153039-2153061 GGCCAAGGTGAGTCAGGGCAGGG + Exonic
1136288924 16:29260092-29260114 GGCGGAGGAGGGAGAGCCCAAGG - Intergenic
1137785933 16:51137769-51137791 GGAAGAGGGGAGACAGCCCAGGG - Intronic
1138200333 16:55083616-55083638 GGCAGAGGTGCCCCAGCCCAAGG - Intergenic
1139589657 16:67926570-67926592 GGCTGAGATGAGGCAGCCCGGGG + Intronic
1140192489 16:72829763-72829785 GGCGGAGGTGAGAAAGACCAGGG - Exonic
1141824712 16:86471049-86471071 GGCCAGGGTGAGATATCCCAGGG + Intergenic
1141860750 16:86714504-86714526 GGCCATGGAGAGCCAGCCCAGGG + Intergenic
1142305063 16:89280202-89280224 GGCCGAGGTGAGACAGGCCGCGG + Exonic
1142582763 17:952244-952266 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582782 17:952308-952330 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582801 17:952372-952394 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582820 17:952436-952458 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582839 17:952500-952522 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142582875 17:952628-952650 GGCTGGGGTCAGACAGACCAAGG + Intronic
1142737264 17:1908757-1908779 GGCCTCTGTGAGACACCCCAGGG - Intergenic
1144564627 17:16349706-16349728 GGCCCAGGTGACACAGAGCAGGG - Intronic
1145750245 17:27349841-27349863 GGCGGGGGTGTGACAGCCCTCGG - Intergenic
1146399919 17:32494313-32494335 GCCCAAGGTGAGCCAGCCCTGGG - Exonic
1146419286 17:32667697-32667719 GACCAAGGTAAGACAGCTCAGGG - Intronic
1147198309 17:38782391-38782413 GGATGTGGTTAGACAGCCCAGGG + Intronic
1148624040 17:49055330-49055352 GGATGGGGTGAGACAGGCCAGGG - Exonic
1149161172 17:53694837-53694859 GGCCGAGGTGAGTGATCACAAGG + Intergenic
1150496698 17:65613270-65613292 GGTCGAGGTGAACCAGCCAAAGG + Intronic
1157278124 18:46326734-46326756 GGCAGAGGGGAGACCGTCCAAGG + Intergenic
1157278133 18:46326768-46326790 GGCAGAGGGGAGACCGTCCAAGG + Intergenic
1157278142 18:46326802-46326824 GGCAGAGGGGAGACCGTCCAAGG + Intronic
1157278151 18:46326836-46326858 GGCAGAGGGGAGACCGTCCAAGG + Intronic
1157593682 18:48851134-48851156 GGCAGAGGACAGACTGCCCAGGG - Intronic
1158677646 18:59536335-59536357 GGAGGAGGAGAGAGAGCCCAGGG - Intronic
1160376853 18:78420254-78420276 AGCAGAGACGAGACAGCCCAGGG - Intergenic
1160809711 19:1008093-1008115 GGGCCAGGTGGGACAGCCCCAGG - Intronic
1161123594 19:2543809-2543831 TGCCGGGGTGAGTCAGCCCCGGG + Intronic
1161261892 19:3342371-3342393 GGCAGAGGACAGAGAGCCCAGGG + Intergenic
1161470707 19:4455637-4455659 AGCCCAGGGGAGACAGGCCACGG - Intronic
1161935287 19:7368261-7368283 TCCAGAGGTGAAACAGCCCAGGG - Intronic
1162019818 19:7863274-7863296 GGCCGAGGTGAGCCGGCGCGGGG + Exonic
1162158928 19:8697759-8697781 GGCCGACGGGTGACAGCCCCGGG + Exonic
1162926192 19:13931632-13931654 GGCCCAGGAGAGCCAGACCAAGG + Intronic
1163550833 19:17965822-17965844 GGCCGTGGTGACAATGCCCAGGG - Intronic
1165081640 19:33310299-33310321 GGTCCAGGTGAGAAAGCCCCGGG - Intergenic
1165897451 19:39151376-39151398 GGCCGAGGGGAGATAGGCCCTGG + Intronic
1166239449 19:41480058-41480080 GGCCGCCGTGACTCAGCCCATGG - Intergenic
1167492904 19:49802181-49802203 GGCCGAGAAGGGACAGCCCTGGG - Intronic
925275205 2:2643712-2643734 AGACAAGGGGAGACAGCCCAGGG - Intergenic
927517718 2:23681905-23681927 GGCGGAGGGGAGACAGCACAGGG - Intronic
933729574 2:85446571-85446593 GGGAGAGGTCAGACAGCCCCTGG + Intergenic
934735860 2:96689485-96689507 GGCCGAGGTGCACCAGGCCAAGG + Intergenic
936092445 2:109510195-109510217 GGCTGAGGTGAGAATGGCCAGGG + Intergenic
936449664 2:112624653-112624675 GGGTGAGGAGAGGCAGCCCAGGG + Intergenic
937244728 2:120485275-120485297 GGCCCAGGAGAGGCAGGCCAGGG + Intergenic
944461641 2:199955885-199955907 GGCCGAGGTGAGGCTGCCGTCGG + Exonic
946101279 2:217326615-217326637 GGCCCAAGTGAGAGACCCCAGGG + Intronic
949041370 2:241851418-241851440 GGCAGTGGTGGGACAGCTCAGGG - Intronic
1171438244 20:25140468-25140490 GGCCAAGGTGAGACAGCTCCAGG + Intergenic
1171988541 20:31677844-31677866 GGCCTAGGGGACAGAGCCCATGG - Intronic
1174207327 20:48850284-48850306 GGCCGAGGGGAGGAAACCCAGGG + Intergenic
1175384291 20:58584311-58584333 GCCTGAGGTCACACAGCCCAGGG - Intergenic
1175995515 20:62810559-62810581 GGTCGAGGTGAGCCAGGCCTTGG + Exonic
1176190005 20:63804072-63804094 GGCTGAGATGGGACAGCGCAGGG - Intronic
1176300401 21:5096436-5096458 GGCCGAGAGGAGAAAGCCCCAGG + Intergenic
1179856643 21:44165545-44165567 GGCCGAGAGGAGAAAGCCCCAGG - Intergenic
1181058560 22:20271151-20271173 GTGGGAGGTGAGACAGCCCCTGG - Intronic
1181901809 22:26162179-26162201 GCCAGAGGTCAGACAGCCCTGGG + Intergenic
1182041476 22:27241926-27241948 GGCCAGGGGCAGACAGCCCAGGG + Intergenic
1183308374 22:37096099-37096121 GGCAGAAGTGAGAGAGGCCAGGG + Intronic
1184643816 22:45885596-45885618 GGACCAGGAGACACAGCCCAGGG + Intergenic
1184666290 22:45990798-45990820 GGCATAGGTGAGACACCCCATGG + Intergenic
1185007973 22:48295840-48295862 GGCAGAGCCAAGACAGCCCAAGG + Intergenic
1185059246 22:48597473-48597495 GGCCCAGGTGATGCAGGCCATGG - Intronic
950184234 3:10935193-10935215 GCCCGAGGTGAGACCGCCCCAGG + Exonic
950533847 3:13568399-13568421 GGAGCAGGTGAGAGAGCCCAGGG - Intronic
952278339 3:31899592-31899614 GGCCGAGGTGAGAGAACCACTGG + Intronic
961467641 3:127091262-127091284 GGCCGAGGTGACACAGCCAGTGG - Intergenic
962135516 3:132727648-132727670 GCCCAAGGGGAAACAGCCCAGGG - Intergenic
962753530 3:138451649-138451671 GGCCGAGGTGGGAGAGGACATGG - Intronic
963405574 3:144859372-144859394 GGCCGAGAGCAGACAGCTCACGG - Intergenic
964567532 3:158073808-158073830 TACAGAGGAGAGACAGCCCAGGG + Intergenic
966378872 3:179323486-179323508 GGCCGAGGGGAGCCCGGCCAAGG - Intronic
967722179 3:192827389-192827411 CGTGGAGGTGAGCCAGCCCAGGG - Intronic
968178243 3:196569296-196569318 GGCCAAGGTGAGAGAGCCCCGGG + Exonic
968226983 3:196978995-196979017 AGCCGAAGGGAAACAGCCCAGGG - Intergenic
968327821 3:197835732-197835754 GGCCGAGGTGAGACAGCCCAAGG + Exonic
968488558 4:877074-877096 GGCCAAGGTGAGAGAGCCTGTGG - Exonic
968569629 4:1332799-1332821 GGACGAGGTGCGCCAGGCCATGG + Exonic
968761614 4:2445209-2445231 GGCCAAGGTCACAGAGCCCAAGG + Exonic
969569810 4:8001737-8001759 GGGCGTGGAGGGACAGCCCAGGG - Intronic
970441302 4:16083216-16083238 GACCGAGGTGAGACTCGCCAGGG - Intronic
971845704 4:31915661-31915683 GGCAGAGGTGGAACAGCTCAAGG + Intergenic
972335115 4:38100965-38100987 GGCCGGTGAGTGACAGCCCAGGG - Intronic
976824957 4:89250007-89250029 TGCCGAGGTGAGGCAGCCTGTGG + Exonic
977323781 4:95549592-95549614 AGCCGAGGCGAGACAGACCAGGG + Intergenic
984750370 4:183267090-183267112 GACCAAGGTGGGAGAGCCCAGGG - Intronic
985644996 5:1080626-1080648 GGCCGAGTGGAGACAGCCGGGGG + Intronic
987199295 5:15558452-15558474 GGCCAAGGGGAGCCAGCCAAAGG + Intronic
988718175 5:33848283-33848305 GGCTGAGCTGAGACACTCCAAGG - Intronic
992816070 5:80440152-80440174 GGCTTAGGTGGGACATCCCAAGG + Intronic
997440690 5:133906826-133906848 GGCTGAGGTCAGAGAGGCCAAGG - Intergenic
997527435 5:134562377-134562399 CGTGGAGGTGAGGCAGCCCAAGG + Intronic
997918929 5:137958577-137958599 GCCAAAGGTGAGACAACCCAGGG + Intronic
1001552357 5:172612166-172612188 GGCCAAGCTGAGACAGGACAAGG - Intergenic
1002786906 6:408395-408417 GGCCAAGGAGAGAAAGCCAATGG - Exonic
1003625601 6:7738484-7738506 GGTCGTGGTGAGGCAGCCCATGG - Intronic
1003939448 6:11009727-11009749 TGCTGGGGTTAGACAGCCCAAGG + Intronic
1005475882 6:26207355-26207377 GGCAGAGGTGAGGCAGACAATGG + Intergenic
1005512099 6:26520800-26520822 GGCGGGCGTGAGCCAGCCCAGGG - Intergenic
1006372548 6:33654370-33654392 GGCCTAGGTGGGGCAGCCCTTGG + Intronic
1006393571 6:33772812-33772834 TGCCGAGGTGAGCCAGCCTGTGG + Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1012474882 6:99607384-99607406 GGCCGAGAGGCGACAGCCCTGGG + Intronic
1019421465 7:953162-953184 GTCTGGGGTGAGCCAGCCCAGGG + Intronic
1019518848 7:1451643-1451665 GGCCGGGGTGAGGCAGGACACGG - Intronic
1019538762 7:1542020-1542042 GGCAGAGGACAGACAGCCCCGGG + Exonic
1020279411 7:6642803-6642825 GGCTGAGGTGGGCCAGGCCAGGG + Intronic
1021554438 7:21904933-21904955 GGCCGAGGTGATGCCACCCAAGG - Intronic
1022536945 7:31104172-31104194 GGCCCAGGAGTGAGAGCCCAGGG + Intronic
1022810324 7:33861853-33861875 GGCAGAGGTGGGACAGCACTGGG + Intergenic
1023959275 7:44913092-44913114 GGCCGAGGTGAGGCAGGTCCTGG + Intergenic
1024323873 7:48093725-48093747 GGCTGACCTGAGTCAGCCCACGG - Intronic
1024912987 7:54467099-54467121 GGCATAGGTGAGACAGCTCTTGG + Intergenic
1030219218 7:107079618-107079640 GGCCTAGATAAGAGAGCCCATGG - Intronic
1031649897 7:124275975-124275997 TGGAGAGGTGAGGCAGCCCAAGG - Intergenic
1033677448 7:143556824-143556846 GCCCCAGGTGTGATAGCCCAGGG + Intergenic
1033694386 7:143772612-143772634 GCCCCAGGTGTGATAGCCCAGGG - Intergenic
1036641241 8:10585348-10585370 GACCGAGGAGAGACTCCCCAGGG - Intergenic
1038708829 8:29921842-29921864 GGCCCAGATGAAACTGCCCAAGG - Intergenic
1041393062 8:57364588-57364610 GGCTGAGGAAAGACAGGCCACGG + Intergenic
1042479857 8:69290926-69290948 AGCAGAGGGTAGACAGCCCATGG - Intergenic
1046611957 8:116435681-116435703 CCCCGAGTTGAGAAAGCCCAAGG + Intergenic
1049178870 8:141210235-141210257 GGCCGAGGTGAGGAAGCCAGGGG + Intronic
1053181289 9:35972394-35972416 GGCGGAGGTGGGGCTGCCCAGGG + Intergenic
1055731238 9:79281248-79281270 AGCTGAGGTGGGACCGCCCAGGG + Intergenic
1056544260 9:87600915-87600937 GGGCGAGCTCAGACAGACCAGGG - Intronic
1056754357 9:89372778-89372800 TGCCCAGGTGAGACAGCACATGG - Intronic
1057037070 9:91818795-91818817 GCCAGAGGTGAGGCTGCCCAAGG - Intronic
1057291689 9:93810863-93810885 GGCCGAGGGGAGACAGGTCTGGG + Intergenic
1058069330 9:100585655-100585677 GGCAGAGGATAAACAGCCCATGG + Intronic
1060730408 9:126033510-126033532 GGCCAGGGTGAGCAAGCCCAGGG - Intergenic
1060889052 9:127176777-127176799 GGGAGAGGTGGGAGAGCCCAGGG + Intronic
1062044135 9:134417444-134417466 GGCCGAGCTGAGGCAGCCACAGG - Intronic
1062445312 9:136591316-136591338 TGCGGAGGTCAGACAGACCATGG + Intergenic
1062485610 9:136773790-136773812 GGCCGAGGGGAGAGAGGACATGG - Intergenic
1062496266 9:136833165-136833187 GACCCAGGTGGGGCAGCCCAGGG - Intronic
1062647441 9:137556031-137556053 AGCAGAGGTGAGAAAGTCCAAGG + Intronic
1203769869 EBV:44239-44261 GGCCGAAGGGAGACAGGCGAAGG + Intergenic
1187112243 X:16313921-16313943 AGCAGAGGTGAGACAGAGCAGGG + Intergenic
1192798341 X:74443102-74443124 GGCCTAAGTGAGATAACCCATGG - Intronic
1195252483 X:103062995-103063017 GGAGGAGGTGAGACAGCTGATGG - Exonic
1195278682 X:103309688-103309710 GGAGGAGGTGAGACAGCTGATGG - Exonic
1195520242 X:105821948-105821970 GGCCAAGCTGTGACAGCCCCGGG + Intergenic
1198870604 X:141174582-141174604 GGCCCAGGAGTAACAGCCCATGG + Intergenic