ID: 968332318

View in Genome Browser
Species Human (GRCh38)
Location 3:197881560-197881582
Sequence CAGTAGCAGGAGAAGTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968332315_968332318 -6 Left 968332315 3:197881543-197881565 CCTTCTTAATAGTGAAACAGTAG 0: 1
1: 0
2: 0
3: 17
4: 160
Right 968332318 3:197881560-197881582 CAGTAGCAGGAGAAGTATTAGGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968332318 Original CRISPR CAGTAGCAGGAGAAGTATTA GGG Intronic
902695542 1:18138403-18138425 CAGTAGCAGTAGTAGGAATACGG - Intronic
903448938 1:23439677-23439699 CTGTTACAGGAGAAGTGTTACGG - Intronic
903864202 1:26386364-26386386 CAGTGTCAGCAGAAGTCTTAGGG + Intergenic
906519617 1:46459342-46459364 CAGCAGCATGAGAAGTTTTGAGG - Intergenic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
914855131 1:151345205-151345227 CAGAGGCAGGAGAAATAATAAGG + Intronic
914901373 1:151712980-151713002 AGGTAGCAGGAGAAGACTTAGGG + Intronic
916029335 1:160862636-160862658 GAGGAGCAGGAGGAGTATGAGGG + Exonic
916934866 1:169617237-169617259 CAGTAGTAGGAGCTGTAGTAGGG + Exonic
917973717 1:180225264-180225286 CAACAGCAGGAGAATAATTAAGG + Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
921589087 1:216982706-216982728 CAGTAGCAAGAAAACTATAAAGG + Intronic
922621727 1:226994131-226994153 CAGTAGCAGGACAGGGATTCAGG - Exonic
923851790 1:237804134-237804156 CAGTACCATGAGAAGGATAACGG - Intronic
1064294695 10:14067910-14067932 TAGTAGCAGTAGAAGTACCAGGG + Intronic
1065112503 10:22453612-22453634 CAATGGCAGGAGAAGTTTTGTGG + Intronic
1069102668 10:64342419-64342441 CTGGAGAAGGAGAGGTATTATGG - Intergenic
1069103242 10:64350676-64350698 CAGTAGGAGGAGATGTAATGAGG + Intergenic
1069784626 10:70979847-70979869 CAGGGGCAGGAGAAGTGTTAGGG - Intergenic
1071374841 10:84991869-84991891 CAGTGGCAGGGGAAGAATTTAGG - Intergenic
1074645145 10:115441269-115441291 CAATAGTTGGAGAAGTATAAGGG - Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1086571029 11:88284829-88284851 CATTAGCAAGGGAGGTATTAAGG - Intergenic
1089922662 11:122225026-122225048 CAGCAGCAGTAGAAGTAACAAGG + Intergenic
1090220162 11:125013739-125013761 CAGGAGCATGTGAAATATTAAGG + Intronic
1092837941 12:12509623-12509645 CAATAGCTGGAGAAGTAAGACGG - Intronic
1092892653 12:12983150-12983172 CAACAGCAGGAGAAGTTTGATGG - Intronic
1093661169 12:21758605-21758627 GAGCAGCAGGAGAAGTATGGTGG - Intergenic
1094121236 12:26976933-26976955 CAGCAGCAGGAGAAGGGTTTGGG - Intronic
1095155509 12:38848885-38848907 GAGGAGAAGGAGAAGCATTATGG - Intronic
1095435391 12:42181305-42181327 AAGCAGTAGGAGAAGTAGTAAGG - Intronic
1096595848 12:52695017-52695039 CAGCTGCAGGAGAAGTGTGATGG - Intronic
1099451172 12:82808680-82808702 CAGTGGCAGGAGAAGAATACTGG - Intronic
1099982216 12:89617985-89618007 TAGTAGCAGGAGAAATAAAAAGG - Intronic
1100856345 12:98760736-98760758 CACTTGGAGTAGAAGTATTAGGG - Intronic
1105666014 13:22557364-22557386 CAGGAGGAGGAGAAGGAATATGG + Intergenic
1109679538 13:65731942-65731964 CAGTGGCAGGAGAAGTTCTATGG + Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1111685177 13:91492943-91492965 CAGTAGCAAGAGAAGCACTGGGG - Intronic
1112770724 13:102792062-102792084 GAGGAGCAAGAGAAGTATGACGG + Intronic
1114016362 14:18433310-18433332 CAGAAGCAGTAGCAGTATTCTGG + Intergenic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1123448482 15:20345847-20345869 CAGGAGCAGGAGCAGGATCAGGG + Intergenic
1126676425 15:51162579-51162601 TAGTAGCTGGAGAAGTAGCATGG + Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127636870 15:60879336-60879358 CAGTAACATGAGAATAATTATGG + Intronic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1128535856 15:68489734-68489756 CAGCAGCAGAAGAGGTATTTGGG - Intergenic
1131810324 15:96166639-96166661 CATTAGGAGGAGAAGAAATAGGG - Intergenic
1135606018 16:23825424-23825446 TAGTAGCAGTAGTAGTAGTATGG + Intergenic
1135650506 16:24202219-24202241 CAGTAGTAAGAGTAGTAGTAAGG - Intronic
1137295073 16:47084523-47084545 CAGCAGCAGGAGCCCTATTATGG + Intronic
1146505660 17:33402424-33402446 CAGTGGCAGGAAGAGCATTAGGG - Intronic
1153128105 18:1820576-1820598 CAGGTGCAGAAGAAGCATTAAGG + Intergenic
1156509924 18:37627750-37627772 CTGTAGGAGGGGAAGTATTTGGG + Intergenic
1156701982 18:39836605-39836627 GAGTAACAGGAGAAGTCTAAAGG + Intergenic
1159214325 18:65370800-65370822 AAGTAGCAGGATAAGATTTAAGG + Intergenic
1164167782 19:22697993-22698015 CAGTAGAAGTAAAAATATTACGG - Intergenic
1165610141 19:37144166-37144188 CCTTCTCAGGAGAAGTATTATGG + Intronic
928997188 2:37305472-37305494 CAGTAGCAGGAGCATTATAGTGG + Intronic
931636098 2:64341816-64341838 GAGAAGCAGGAGAAGTACTCTGG - Intergenic
934946204 2:98543772-98543794 CATTTGCAGGGGAAGTATCATGG - Intronic
940263585 2:151812165-151812187 CAGAAGCAGCAGAAAGATTATGG - Intronic
941395154 2:164964799-164964821 CCTTGGCAGTAGAAGTATTAGGG + Intergenic
943004937 2:182377308-182377330 CAGGAGCAGGAGAAAGATAAAGG - Intronic
944054504 2:195509495-195509517 AAGTAGCTGGAGAAGAATTTGGG - Intergenic
944562527 2:200955003-200955025 CAGTAGCAGGGGTAGGGTTAGGG + Intronic
945422248 2:209653139-209653161 CAGTTGCAGGAGAAATAACAAGG + Exonic
945917827 2:215722725-215722747 AAATAACAGTAGAAGTATTATGG - Intergenic
1169647308 20:7826842-7826864 TAGTAGCAGAAGTAGTGTTAGGG + Intergenic
1170672122 20:18444062-18444084 CAGTAGCAGGAAAGGAATTAGGG - Intronic
1173332183 20:42084712-42084734 AAGTGGCAGGAGCAGTATGACGG - Exonic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1177495107 21:21878821-21878843 CAGGAACAGGAGAAGTTTTCTGG - Intergenic
1178836844 21:36105442-36105464 CAGTAGCAAGAAAAATATTCAGG + Intergenic
1180440869 22:15364183-15364205 CAGAAGCAGTAGCAGTATTCTGG + Intergenic
1183881125 22:40831304-40831326 CAGTAGGAAGAGTATTATTACGG + Intronic
1184968401 22:47997754-47997776 CAGTGGCAGGCGAATGATTAGGG + Intergenic
951682062 3:25305254-25305276 CTGTAGGAGGAGAGGTTTTAAGG + Intronic
952914968 3:38229689-38229711 CAACAGCAGCAGAACTATTAAGG + Exonic
953078214 3:39591254-39591276 CAGAAATAGGAGAAGTCTTATGG - Intergenic
962024850 3:131537192-131537214 TATTAGCAGGAGTAGTATTTCGG + Intronic
962028230 3:131571606-131571628 CAGCAGCAGGAGAGGTACTGTGG - Intronic
968332318 3:197881560-197881582 CAGTAGCAGGAGAAGTATTAGGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
970375915 4:15456914-15456936 CAGTAGGAAGACAAGTATTTTGG - Intergenic
972097410 4:35364927-35364949 CAGTATTAGGAGAAGTAGCAGGG - Intergenic
972205958 4:36773175-36773197 CATTAGCAGAAGAACAATTAGGG - Intergenic
975032337 4:69636452-69636474 CAGTAACATGAGAAGCATAAAGG + Intronic
977423003 4:96827645-96827667 GAGTAGCATGAGAGTTATTAGGG + Intergenic
978940820 4:114434494-114434516 CAGTAGCAGTAGCAGCATTATGG + Intergenic
979235992 4:118400974-118400996 CAGTAGCAGGAGAGTAATTTAGG - Intergenic
979776945 4:124601357-124601379 CAATATCAGGAAAAGTATTAAGG - Intergenic
980140268 4:128907283-128907305 CTGTAGCAGGAAAAATAGTAAGG + Intronic
980398070 4:132241623-132241645 TAGTAGCAGTAGTAGTAGTAAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
982483723 4:155941673-155941695 CAGTAGCATGACAGGGATTATGG - Intronic
982853501 4:160349982-160350004 CAGTAGCAGACTAAGTATGACGG - Intergenic
982853535 4:160350982-160351004 CAGTAGCAGACTAAGTATGACGG + Intergenic
986486635 5:8244628-8244650 CAGCAGCGGGAGAAGTATGCAGG + Intergenic
986887896 5:12262553-12262575 CACTGGCAGGACAAGGATTAGGG - Intergenic
987342557 5:16951614-16951636 TAGGAGCAGGAGTAGTATTCAGG - Intergenic
988264769 5:28933782-28933804 CAATAGCAGAAGAATCATTAAGG + Intergenic
989233398 5:39114927-39114949 CAGCAGCAAAAGAAGTATCATGG + Intronic
989582417 5:43045280-43045302 AGGTAGCAGAAGAAGTAGTATGG - Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
992542458 5:77778431-77778453 CAGTAGCAGCAGAGGTCTTTTGG - Intronic
992626184 5:78637726-78637748 GAGTAGCAGGGGAAGCATCACGG + Intronic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
997043600 5:130286764-130286786 CACCAGCAGGAGAAGAAGTAGGG - Intergenic
997368163 5:133338979-133339001 CAGTAGCTGGAGGAATCTTATGG + Intronic
999472731 5:151870209-151870231 CAGTATCAGGCGAAGAATTTTGG + Intronic
1000279108 5:159766922-159766944 CAGTAGCTGGAAAAGGATAAGGG - Intergenic
1000839786 5:166203919-166203941 CATCAGCAGCAGCAGTATTAAGG - Intergenic
1001005328 5:168044773-168044795 CAGTAGCAGAATAAGAAATAGGG + Intronic
1002780263 6:359731-359753 CAGAAGCAGAAGCAGCATTAGGG + Intergenic
1003491405 6:6625739-6625761 CAGCAGCTGGAGAAATGTTATGG + Intronic
1007221598 6:40283140-40283162 CTGCAGCAGTAGAAGCATTAGGG + Intergenic
1007898563 6:45387985-45388007 GAGTAGCTGGAGAAATATTCAGG + Intronic
1009713593 6:67357459-67357481 TAGTAAAAGTAGAAGTATTAAGG - Intergenic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1011368711 6:86609339-86609361 AGGTAGAAGGAGGAGTATTAAGG - Intergenic
1013506760 6:110808030-110808052 AAGTTACAGGAGAAATATTAAGG - Intronic
1014879567 6:126706344-126706366 TGGTATCAGGAGAAGAATTAGGG + Intergenic
1015289172 6:131519326-131519348 CTGTTGCAGGAGAATTATTGTGG + Intergenic
1015426402 6:133073916-133073938 CAGTAGCATGTTAAATATTAAGG - Intergenic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017404409 6:154102762-154102784 CAATAGCTGGAGAAACATTAAGG + Intronic
1019289205 7:242111-242133 CAGTAGCAGGCGAAGTACAATGG - Intronic
1021395860 7:20147450-20147472 CATTAGCTGAAGAAGTATTAAGG + Intronic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1027652814 7:80891371-80891393 GGGAAGCAGTAGAAGTATTATGG - Intronic
1030435996 7:109521420-109521442 CAGGAGCAGGAGAAGACTTGAGG - Intergenic
1031110373 7:117600579-117600601 CAATAGCAGCAGTGGTATTATGG - Intronic
1031633304 7:124070478-124070500 CAGCAGCAGAAGTAGTATTTTGG + Intergenic
1032606283 7:133357862-133357884 CTGTGGCAGGAGAAGGATAAAGG - Intronic
1033831904 7:145264986-145265008 CAGAAGCAGGACAAGGAATAGGG - Intergenic
1036289368 8:7473755-7473777 CATTAGCAGGAAGAGGATTAGGG - Intronic
1036332113 8:7837777-7837799 CATTAGCAGGAAGAGGATTAGGG + Intronic
1039538774 8:38344239-38344261 AAGTAGCAGGTGAAATCTTAAGG + Intronic
1042441535 8:68832624-68832646 GAGTAGCAGGAGAACTAATCTGG - Intergenic
1043620288 8:82182418-82182440 CAGAAGCAGGATAAGTGATATGG + Intergenic
1044114913 8:88324137-88324159 CACTACCAGGAGTAGTACTATGG - Intronic
1044902306 8:96959798-96959820 AGGTAGCAGGAAAAGTCTTAGGG - Intronic
1046796626 8:118380477-118380499 CAGTAGGAAGAGAAGTATACAGG - Intronic
1047674647 8:127187070-127187092 TTGTTGCAGCAGAAGTATTATGG - Intergenic
1051396174 9:16623802-16623824 CAGTAGCAGGAAAGGTAAAAAGG + Intronic
1051503825 9:17806375-17806397 AGGTAGAAGGAGAAATATTAAGG + Intergenic
1051608875 9:18942494-18942516 CATTAGCAGGAGAAGCTTTTGGG - Intronic
1053105622 9:35405593-35405615 GAGTAGCAGGAGAGGTATTCTGG + Intergenic
1055834452 9:80421725-80421747 CAGTAGCTGGAGATGCACTAGGG - Intergenic
1059581510 9:115554551-115554573 CAGCAGAAGGAAAAGTATCAAGG - Intergenic
1059865925 9:118513889-118513911 CTGAAGCAGGAGAATTGTTAAGG + Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1188129046 X:26407889-26407911 GAGTAGCAGGAGCAGAAATAAGG - Intergenic
1188376296 X:29432774-29432796 AAGTAGAAGGAGAAGTATTATGG - Intronic
1189152281 X:38720727-38720749 CAGGAACAGGAGCAGAATTAGGG + Intergenic
1189683620 X:43541557-43541579 CAGCAGCAGGAGAAGCATCTGGG + Intergenic
1192794454 X:74414920-74414942 CGGAAGCAGCAGAAGCATTATGG - Intergenic
1195481134 X:105346748-105346770 CAGAAGCAGCTTAAGTATTAAGG + Intronic
1196415437 X:115466136-115466158 CAGCAGCAGCAAAAGTATTAAGG - Intergenic
1196497878 X:116343589-116343611 CGGTAACAGGAAAAGTACTATGG + Intergenic
1196696063 X:118613320-118613342 CAGTGGCAGCAGAAGTATAAAGG + Intronic
1201646680 Y:16240981-16241003 AAATAGCTGGGGAAGTATTATGG + Intergenic
1201656133 Y:16344336-16344358 AAATAGCTGGGGAAGTATTATGG - Intergenic