ID: 968341577

View in Genome Browser
Species Human (GRCh38)
Location 3:197960191-197960213
Sequence TGACGCCTCTGCGCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968341577_968341583 24 Left 968341577 3:197960191-197960213 CCGGCGCGGGCGCAGAGGCGTCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 968341583 3:197960238-197960260 GCCCGAAGATGGCGGCCGAATGG 0: 1
1: 0
2: 0
3: 6
4: 22
968341577_968341588 29 Left 968341577 3:197960191-197960213 CCGGCGCGGGCGCAGAGGCGTCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 968341588 3:197960243-197960265 AAGATGGCGGCCGAATGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 103
968341577_968341581 13 Left 968341577 3:197960191-197960213 CCGGCGCGGGCGCAGAGGCGTCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 968341581 3:197960227-197960249 AACGACGCTCGGCCCGAAGATGG 0: 1
1: 0
2: 0
3: 0
4: 15
968341577_968341587 26 Left 968341577 3:197960191-197960213 CCGGCGCGGGCGCAGAGGCGTCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 968341587 3:197960240-197960262 CCGAAGATGGCGGCCGAATGGGG 0: 1
1: 0
2: 0
3: 0
4: 31
968341577_968341585 25 Left 968341577 3:197960191-197960213 CCGGCGCGGGCGCAGAGGCGTCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 968341585 3:197960239-197960261 CCCGAAGATGGCGGCCGAATGGG 0: 1
1: 0
2: 0
3: 1
4: 18
968341577_968341582 16 Left 968341577 3:197960191-197960213 CCGGCGCGGGCGCAGAGGCGTCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 968341582 3:197960230-197960252 GACGCTCGGCCCGAAGATGGCGG 0: 1
1: 0
2: 0
3: 1
4: 29
968341577_968341579 2 Left 968341577 3:197960191-197960213 CCGGCGCGGGCGCAGAGGCGTCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 968341579 3:197960216-197960238 CACTCCATGGTAACGACGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968341577 Original CRISPR TGACGCCTCTGCGCCCGCGC CGG (reversed) Intronic