ID: 968346882

View in Genome Browser
Species Human (GRCh38)
Location 3:198015957-198015979
Sequence CAGTTTGGGAAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 648}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968346877_968346882 -10 Left 968346877 3:198015944-198015966 CCTGTAATCCCAGCAGTTTGGGA 0: 3736
1: 305315
2: 267640
3: 204299
4: 224308
Right 968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG 0: 1
1: 0
2: 5
3: 68
4: 648
968346874_968346882 14 Left 968346874 3:198015920-198015942 CCGGGTGTGGTGTGGTGGCTCAT 0: 4
1: 16
2: 57
3: 734
4: 3204
Right 968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG 0: 1
1: 0
2: 5
3: 68
4: 648
968346869_968346882 25 Left 968346869 3:198015909-198015931 CCCCTGGTGGGCCGGGTGTGGTG 0: 1
1: 0
2: 19
3: 126
4: 640
Right 968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG 0: 1
1: 0
2: 5
3: 68
4: 648
968346870_968346882 24 Left 968346870 3:198015910-198015932 CCCTGGTGGGCCGGGTGTGGTGT 0: 1
1: 1
2: 5
3: 83
4: 429
Right 968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG 0: 1
1: 0
2: 5
3: 68
4: 648
968346871_968346882 23 Left 968346871 3:198015911-198015933 CCTGGTGGGCCGGGTGTGGTGTG 0: 1
1: 0
2: 1
3: 23
4: 357
Right 968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG 0: 1
1: 0
2: 5
3: 68
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968346882 Original CRISPR CAGTTTGGGAAGAGGGAAGA TGG Intronic
900746151 1:4362060-4362082 CAGCTGGGGGAGAGGGGAGATGG + Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901660072 1:10793863-10793885 AAGTTTGGGAAGTGGGAAAGCGG + Intronic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902242236 1:15096712-15096734 CACATGGGGAAGAAGGAAGAGGG + Intronic
902583252 1:17422653-17422675 CAGTTTGGCAAGAGGCCAGGTGG - Intronic
903052879 1:20614694-20614716 GAATTTGAGAAGAGGCAAGAAGG + Intronic
903249622 1:22043357-22043379 CAGTTAGAGAAAAGGCAAGAAGG + Intergenic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904454436 1:30638866-30638888 CAGGTTTGGAAAAGGGAGGAGGG + Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
905839551 1:41163021-41163043 CAGTTTGGGCAAAGAGAAGGAGG + Intronic
906201951 1:43966175-43966197 CAGTTTGTGAACAGGGTAGCAGG - Intronic
906306904 1:44725220-44725242 GAGTGTGGGACGAGGGAAGCCGG + Intronic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
908131450 1:61079796-61079818 CAACTTGGGAAGAGGGGAGAGGG + Intronic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911125747 1:94339628-94339650 CAGTTTGCAAAGAGGAGAGATGG - Intergenic
911190091 1:94939842-94939864 TAGGTTGGGAAGGTGGAAGAAGG - Intergenic
912650893 1:111438260-111438282 CAGTTTTGGAAGAGTAAACAAGG - Intergenic
912816082 1:112829751-112829773 TAGTTTTGGGAGAGGGAAGCTGG - Intergenic
913149736 1:116029010-116029032 CAGTTTAGAAAGAGAGAACATGG - Intronic
914919367 1:151837297-151837319 CAGGTGTGGAAGAGGCAAGAGGG + Intergenic
914991196 1:152501027-152501049 ATTTTTGGGAAGAGGGAGGAAGG - Intergenic
915196308 1:154192557-154192579 GAGCTTGGGCACAGGGAAGAGGG + Intronic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915626242 1:157115647-157115669 CAGTTTGGGAAGGAAGAAGAGGG - Intergenic
915871538 1:159564975-159564997 CAGTTGGGGAGGACAGAAGAGGG - Intergenic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916088189 1:161286522-161286544 GAGGCTGGGAAGAGGGGAGATGG - Intergenic
916704112 1:167329202-167329224 CAGTTTGGGGTGGGGAAAGAAGG - Intronic
916821700 1:168404986-168405008 TAGTTTGGGGAAAAGGAAGAAGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917295048 1:173510169-173510191 CATTTTTGGAAGAGGAGAGAAGG - Intronic
917531486 1:175839934-175839956 CAGGTTGGGTAGAGGAAAAAAGG + Intergenic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
917846314 1:179023369-179023391 CAGTTTGGGAACAAGGAAGAAGG + Intergenic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
919186251 1:194154464-194154486 CATTTTGGGCTGAGGGAATACGG + Intergenic
919230658 1:194769101-194769123 GAGTCGGGGAAGTGGGAAGAAGG + Intergenic
919255768 1:195122486-195122508 CACTTTGGGGAGAGGGAAATAGG - Intergenic
919597117 1:199578046-199578068 CTGCTTGGGAAGAGGTAAAATGG + Intergenic
919929802 1:202214014-202214036 GAGTTAGGGAAGAGGGCAGATGG + Intronic
919934318 1:202241551-202241573 CAGTTTGGGAGGGGGGAGAATGG + Intronic
919935669 1:202248944-202248966 CAGTTGGGAAAGAGGAGAGAAGG + Intronic
920034470 1:203056887-203056909 CTGTTTGGGAAGAAGGAGAAGGG + Exonic
920188351 1:204176491-204176513 CATTATGGAAAGTGGGAAGAAGG + Intergenic
921311505 1:213848809-213848831 TATTTTGGTATGAGGGAAGAAGG + Intergenic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
922290900 1:224208154-224208176 CGGGTTGGGCCGAGGGAAGAGGG + Intergenic
922425494 1:225488765-225488787 CAGTTTGGGATGATAAAAGATGG - Exonic
922646405 1:227291174-227291196 CAGGTGGGGAGGAGGGAGGAAGG - Intronic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923742109 1:236664406-236664428 CACTGAGGGAGGAGGGAAGATGG - Intergenic
923904665 1:238370548-238370570 CAGTATGGGAAGAGAGTAGAGGG - Intergenic
924353621 1:243145957-243145979 AAGTTTTGTAAGAGGAAAGAGGG + Intronic
924942609 1:248822476-248822498 CAGTTTAGCAAGAGAGACGAGGG + Intronic
924945543 1:248844323-248844345 AAGTTTGGAAAGAGGGAAGGGGG - Intronic
1062886088 10:1017186-1017208 CTGTCTGGGAAGAGGAAAGCTGG + Exonic
1064179529 10:13102165-13102187 CATTTCGGGCAGAGGGCAGAAGG + Intronic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064712782 10:18143313-18143335 CAGTTTGGGCCGAGGTAATAAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1065641586 10:27787776-27787798 CAGTTTGGGGAGAGGCAAATTGG - Intergenic
1067349077 10:45459361-45459383 TAGTTTGGGAAGGGAGAAGTGGG - Intronic
1067456185 10:46420899-46420921 GGGGTGGGGAAGAGGGAAGAAGG + Intergenic
1067631014 10:47963740-47963762 GGGGTGGGGAAGAGGGAAGAAGG - Intergenic
1068922967 10:62504361-62504383 AATTTTGTGGAGAGGGAAGAGGG - Intronic
1069201500 10:65623178-65623200 CAGTATGGCAAGAGGAAAAAAGG - Intergenic
1069506555 10:69003559-69003581 CTGTTTTGGAAGACGTAAGAGGG + Intronic
1070052433 10:72902420-72902442 GAGTTGGGGAAGAGGGAAATGGG - Intronic
1070295141 10:75154148-75154170 CATTTTTGGAAGTTGGAAGATGG + Intronic
1070496481 10:77028522-77028544 TGGGTTGGGAAGAGAGAAGAAGG - Intronic
1070676635 10:78416220-78416242 TAGTTTCTGAAGAAGGAAGATGG - Intergenic
1070837942 10:79462847-79462869 CAGTTTGGGAGGAGTGAGGGAGG + Intergenic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071155800 10:82687580-82687602 TGGTTTGGGAAGATAGAAGAGGG + Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072850690 10:98888649-98888671 CAGTTTGGGGAGAAAGGAGACGG - Intronic
1072857571 10:98965573-98965595 CTGTTTGGGAAAAGTGAATACGG - Intronic
1072981059 10:100097916-100097938 CAGTTTGGGAAGATATAAAATGG + Intergenic
1074103402 10:110371507-110371529 TAGGTGGGGAGGAGGGAAGAGGG + Intergenic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074608103 10:114994278-114994300 GAGTTTGGGAAGCAAGAAGAGGG + Intergenic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074956012 10:118390564-118390586 CCATTTGGGGAGAAGGAAGAAGG - Intergenic
1075273549 10:121074157-121074179 CTGTTTTGGAAAAGGCAAGAAGG - Intergenic
1075576916 10:123584353-123584375 CATTTGGGGAAGAAGGAAGGGGG + Intergenic
1075933423 10:126319287-126319309 CAGCATGGGAAGGGGGAAAAAGG + Intronic
1075985744 10:126783688-126783710 CAGCTGGGGAAGAAGGGAGAAGG - Intergenic
1076833324 10:133007682-133007704 CAGTCTGGGAACAAGGCAGAGGG + Intergenic
1077302432 11:1853546-1853568 TAGCTTGGGAAGAGGCAAGGTGG + Intronic
1077660532 11:4064671-4064693 GAACTTGGGAAGAGGGAAGAGGG + Intronic
1079019324 11:16896225-16896247 CAGTTTAGGAAGATGGCAAAGGG - Intronic
1079105025 11:17565490-17565512 CAGTATGGAAAGGGGGAAAAAGG - Intronic
1080036862 11:27719876-27719898 GAGGTTGGGAAGAGGGAAGGAGG - Intronic
1080690077 11:34549121-34549143 CAGTTTGGGCAGGGAGAAAATGG - Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081631436 11:44692627-44692649 CAGGGTGGGAAGGGGGAAGCAGG + Intergenic
1081637899 11:44733012-44733034 CAGATGGGGAAGAGGGAGAAGGG + Intronic
1081674402 11:44960204-44960226 CAGTGTGGGAAGAGAAAAGGTGG + Intergenic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082110152 11:48265066-48265088 CAGTCTGGGAATGGTGAAGAGGG + Intergenic
1082711533 11:56559221-56559243 GAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1084380253 11:68807408-68807430 CAGTTTGGGCTTTGGGAAGAAGG - Intronic
1084859125 11:72006769-72006791 AGGTTTGGGAGGAGGGGAGAGGG - Intronic
1085238611 11:75033741-75033763 CAGTGTGGGAAGAGGTCAGGAGG + Intergenic
1085396228 11:76208549-76208571 CACTTTGGGAGAGGGGAAGACGG - Intronic
1085780376 11:79402695-79402717 AGGTTGGGGAAGAGGGAAGTAGG - Intronic
1085965317 11:81516158-81516180 AAGTTTGGGAAGAGAAAATATGG - Intergenic
1086540273 11:87900716-87900738 GAGGTAGGGAAGAAGGAAGAGGG + Intergenic
1087096568 11:94324956-94324978 CAGTTGGGGAAGTAGTAAGATGG - Intergenic
1087498289 11:98917996-98918018 CACATAGGGATGAGGGAAGATGG + Intergenic
1087871142 11:103294604-103294626 GAGTTTGGGGAGAGGCAATATGG + Intronic
1088259350 11:107929123-107929145 GAGTTTGGGAAGAAGGCAGCCGG - Intronic
1088374903 11:109130237-109130259 CACTTTGGGAACAGAGAAGAGGG - Intergenic
1088497538 11:110446657-110446679 CAGGTTGGGAAGAAAGAGGAAGG - Intronic
1088548386 11:110985145-110985167 CATTTTGGGAATAGGAAAGAGGG + Intergenic
1088816159 11:113422473-113422495 CTCCTTTGGAAGAGGGAAGAAGG + Intronic
1089175399 11:116545283-116545305 CAGGTAGGGGAGAGGAAAGATGG + Intergenic
1089761170 11:120724842-120724864 CAAGTTGGCAAGAGTGAAGAGGG - Intronic
1089932622 11:122329311-122329333 TACTTTGCAAAGAGGGAAGAGGG + Intergenic
1090131649 11:124148397-124148419 GAGTTGGGGAAGACGGAGGATGG - Intergenic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1090390965 11:126386942-126386964 CAGTTTGGCAAGTAGGAGGAGGG + Intronic
1090612537 11:128484297-128484319 CGGTTTGGGAAGATACAAGATGG - Intronic
1090709448 11:129372794-129372816 GGGTTTGGAAAAAGGGAAGAAGG + Intergenic
1090988892 11:131798353-131798375 CATCTAGGAAAGAGGGAAGATGG + Intronic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091069958 11:132553798-132553820 GAGTTTGGGAAGGGAGAATATGG - Intronic
1091230016 11:133982203-133982225 CAGATTGCGAAGCGGGAACATGG + Intergenic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094063627 12:26340833-26340855 CACTTGAGGAAGAGGGAAGTGGG + Intronic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1096965062 12:55619426-55619448 CAGTTTGGGAAGTAAGCAGATGG - Intergenic
1097185869 12:57196024-57196046 CAGTCTGGGGAGGGGGCAGAGGG - Intronic
1097298564 12:57994099-57994121 CAGCTGGGGAAAAGGGAATATGG - Intergenic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1097420264 12:59369452-59369474 CATTTTGGGAAGAGGTCAGGTGG - Intergenic
1097730128 12:63119163-63119185 TGGGTTGGGAAGAGAGAAGACGG + Intergenic
1097798037 12:63884682-63884704 GAGACTGGGAAGCGGGAAGAGGG - Intronic
1097811205 12:64021126-64021148 CAGAATGGAAACAGGGAAGAAGG + Intronic
1098140094 12:67442470-67442492 CATTTTGGGGAGAGGGCAGCGGG + Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098773250 12:74581777-74581799 CGTTTTTGGAAGAGGGAGGAGGG - Intergenic
1099585896 12:84513316-84513338 CAGTATGGAAAGGGGGAAAAGGG - Intergenic
1100244908 12:92747883-92747905 GAGGCTGGGAAGAGGGGAGAAGG + Intronic
1100577091 12:95902366-95902388 GAGGTGGGGAGGAGGGAAGAAGG - Intronic
1100685969 12:96986071-96986093 CCTTTGGGGAAGAGGGAGGAAGG + Intergenic
1101521007 12:105482406-105482428 CAGTTTGGGAAATGGCAAGTTGG - Intergenic
1101545285 12:105706655-105706677 CAGATGGGGAGGAGGGATGAGGG - Intergenic
1101660350 12:106759761-106759783 CAGTTAGGAAAGAGGGAGAAGGG - Intronic
1101835137 12:108289658-108289680 AAATGTGGGAAGAGGGGAGATGG + Exonic
1102284114 12:111641338-111641360 TAGTTTGGGAACCTGGAAGAAGG + Intergenic
1102464530 12:113120683-113120705 CAAGTAGGCAAGAGGGAAGATGG + Intronic
1102518955 12:113467473-113467495 CAGTCAGGGAAGGGAGAAGAGGG - Intronic
1102586243 12:113924964-113924986 CAGTTTTAGAAGAAGGAAGTAGG + Intronic
1102682860 12:114702336-114702358 TATTTGGGGATGAGGGAAGAAGG + Intergenic
1103366967 12:120390568-120390590 AAGGGAGGGAAGAGGGAAGAAGG + Intergenic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1104391045 12:128390762-128390784 CAGCCTGGGAAGAGCGAAGCCGG + Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105638125 13:22235919-22235941 TGGTTTGAGACGAGGGAAGAGGG - Intergenic
1105976386 13:25477271-25477293 GAATTTGGGAAGAGGAGAGAGGG - Intronic
1106020949 13:25914899-25914921 CAAATCGGGAAGGGGGAAGAAGG - Intronic
1106063947 13:26325684-26325706 CCGTTTGGGAGGAGTGAAGCAGG + Intronic
1106572523 13:30940186-30940208 TAGTCTTGGAAGATGGAAGAAGG + Intronic
1106874879 13:34060687-34060709 CAGTTCAGGGGGAGGGAAGAAGG - Intergenic
1107318400 13:39159411-39159433 CAGCTGGGAAAGAGGGAAGCTGG - Intergenic
1107563444 13:41578137-41578159 AAGAAAGGGAAGAGGGAAGAAGG - Intronic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1107921870 13:45216929-45216951 CACTTGGGGAAGAGTGAAAATGG - Intronic
1108358577 13:49649827-49649849 TATATTGGGAGGAGGGAAGAAGG + Intergenic
1108434721 13:50390371-50390393 CAGTCTGGCAAGAGTGATGAAGG - Intronic
1108787122 13:53918190-53918212 CAGTTTGGGTAAGTGGAAGATGG + Intergenic
1109260422 13:60138780-60138802 AAGAAGGGGAAGAGGGAAGAGGG + Intronic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110865214 13:80386010-80386032 CAGTTTGGGAATAAGAAATAAGG + Intergenic
1111483772 13:88867989-88868011 GATTTTGGGGAAAGGGAAGAAGG + Intergenic
1111713995 13:91854533-91854555 TAGTTTGGGGAGGGGGAAGAGGG - Intronic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1113547625 13:111166372-111166394 GTGTTTGGGCAGAGGGGAGAAGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114004746 14:18300410-18300432 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1114257129 14:21012645-21012667 CAGGATGGGAAAAGGGATGAGGG + Intergenic
1114417590 14:22554750-22554772 CAGTTAGGGCAGAGGTCAGAGGG + Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114982875 14:28188437-28188459 CAGGTTGGGAGGAGCCAAGATGG + Intergenic
1115030008 14:28784050-28784072 CAGTTGGAGAATAGGGAAAAGGG + Intronic
1115180928 14:30625011-30625033 AAGATTGGGAAAGGGGAAGATGG - Intronic
1115447281 14:33505816-33505838 CAGCCTGGGAAGAGGGGAGATGG - Intronic
1115495065 14:33995292-33995314 CAATTTGGGAAGAAGGGAAAGGG + Intronic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116385652 14:44326585-44326607 CCGTTTGGAAAGAAGGAAGTAGG + Intergenic
1116402160 14:44521243-44521265 CAGTGTGGGAAGAGTGACTAGGG + Intergenic
1117794517 14:59378236-59378258 CTGTTTGGGAAGGGGAAAGGTGG + Intergenic
1117841267 14:59862848-59862870 AAGTTTGAGAAGAGGGGAGAAGG - Intronic
1118011950 14:61618557-61618579 CAGTTTCAGAAGAGGCTAGAAGG - Intronic
1119326525 14:73762795-73762817 CAGTTTGTAAAGAGGGTTGAGGG - Intronic
1119406879 14:74404595-74404617 CAGTTGGGGAGTAGGGAAGGAGG + Intergenic
1119532596 14:75373456-75373478 GAAGTTGGGGAGAGGGAAGAAGG + Intergenic
1119546365 14:75474819-75474841 AAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1120194448 14:81466929-81466951 GAGCTTGGGCAGAGGGCAGAGGG + Intergenic
1121167339 14:91817784-91817806 GAGTTGGGGAAGATGGAGGAAGG + Intronic
1121230681 14:92355322-92355344 GAGATTGGGAAGAGGGCAGATGG + Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1121635138 14:95449172-95449194 TTGTTTGGGAAGAGAGAAGGAGG - Intronic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123458557 15:20447081-20447103 CAGTTTAGCAAGTGGGAAAAGGG - Intergenic
1123659506 15:22553328-22553350 CAGTTTAGCAAGTGGGAAAAGGG + Intergenic
1124010023 15:25830643-25830665 CAGTGAGGGAAGACGGAAGGGGG - Intronic
1124264847 15:28223251-28223273 CAGTTTAGCAAGTGGGAAAAGGG - Intronic
1124313367 15:28647823-28647845 CAGTTTAGCAAGTGGGAAAAGGG + Intergenic
1124512205 15:30336883-30336905 CAGTTGCGGATAAGGGAAGATGG - Intergenic
1124584779 15:30994417-30994439 CAGTCAGGGAGGAGGGCAGAGGG + Intergenic
1124730709 15:32193868-32193890 CAGTTGCGGATAAGGGAAGATGG + Intergenic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1126800436 15:52293197-52293219 CCCTGTGGGAACAGGGAAGAGGG - Intronic
1127062084 15:55196967-55196989 CGGTCGGGGAAGGGGGAAGAAGG - Exonic
1127697809 15:61469027-61469049 CAGCTTGGGAAAAGGGGAGCAGG + Intergenic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128412420 15:67412772-67412794 CACTTTGGGAAGATAGAAAAGGG + Intronic
1128775733 15:70318690-70318712 CAGTTTGGGAAGCAACAAGAGGG + Intergenic
1128814571 15:70598452-70598474 CAGCTTGGCAGAAGGGAAGAGGG - Intergenic
1128867274 15:71123739-71123761 AGGTTGGGGGAGAGGGAAGAGGG + Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129234567 15:74216248-74216270 CATTTTGGGGAGAGGGTAGGTGG - Intergenic
1129695335 15:77737806-77737828 AAGTTAGGTAAGAGGGGAGAAGG - Intronic
1130550318 15:84886451-84886473 CAGTTTGGGAACTGGGGAGAGGG + Intronic
1130567672 15:85011059-85011081 CAGTTTGGAAGGAGGGAATGGGG - Intronic
1130820223 15:87487335-87487357 GAGTTTGGAAACAGGTAAGAGGG - Intergenic
1131626254 15:94123847-94123869 CAGTTCAGGAAAAGGCAAGATGG - Intergenic
1132202120 15:99962239-99962261 CCGGTGGGGAAGAGGGCAGAAGG + Intergenic
1133562182 16:6960570-6960592 GAGTTTGGAAGGAGGTAAGAAGG - Intronic
1134258884 16:12634550-12634572 AAGATGGGAAAGAGGGAAGAGGG + Intergenic
1134267749 16:12706517-12706539 AAGCTTGGGAAAAGGGAGGAAGG - Intronic
1134323365 16:13184158-13184180 TGGTTTGGGAAGAGGCAGGATGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134626730 16:15727727-15727749 CACTTTGGGAAGCAGGCAGAAGG + Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1137373703 16:47932634-47932656 CAATTTCTGAGGAGGGAAGAGGG - Intergenic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1138182909 16:54954902-54954924 CAGGTTGGGAAGGGGGCAGAGGG - Intergenic
1138399148 16:56731279-56731301 CAGTTTGGGGAGAGTAATGAAGG - Intronic
1139203748 16:65005412-65005434 CAGTTTAGGGAGAGGACAGATGG + Intronic
1139672119 16:68499087-68499109 CAGTAGGGGAAGAGGGAGGGAGG - Intergenic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1141042085 16:80681348-80681370 AGGTTAGGGAAGAGGGTAGAAGG + Intronic
1141331994 16:83119264-83119286 GATTATGGGAAGAGGGAAAAGGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142488955 17:265558-265580 AAGGGAGGGAAGAGGGAAGAGGG - Intronic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1142958270 17:3535525-3535547 GAGTCTGGGAGGAGGGAGGAGGG - Intronic
1143016884 17:3895535-3895557 TGGTTGGGGAAGAGGGCAGAAGG + Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143364930 17:6400891-6400913 AAGTTGGGGAAGAGAGAAGGTGG - Intronic
1143472545 17:7185068-7185090 CAGTTTGGGAGGAGGAGAAAAGG + Intergenic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143530722 17:7501768-7501790 AAGTTTGGGAGGAGGAAGGAAGG + Intronic
1143756868 17:9073693-9073715 CAGTTTTTGAAGAGAGAATATGG + Intronic
1144113501 17:12062895-12062917 AAGACTGGGAAAAGGGAAGAGGG - Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1146461628 17:33050498-33050520 GAGTTAGGGAAGAGGGAAGTGGG - Intronic
1146569758 17:33942127-33942149 CAGTTGGGGAAGAAGGGAGAAGG + Intronic
1146687651 17:34852383-34852405 CAGCTTGGGAAGGTGGAGGAGGG - Intergenic
1146918586 17:36694636-36694658 CAGTCTGGGAGGAGGGAACAGGG - Intergenic
1147621956 17:41873973-41873995 GAGATGGGGAAGAGGGAAGCAGG + Intronic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148477822 17:47940961-47940983 CTGAATGGGAAGGGGGAAGAAGG - Intergenic
1149457690 17:56801635-56801657 CAGCTGGGGTAGAGGGCAGATGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150481876 17:65517087-65517109 CAGTTTGGGCAAGGGCAAGAAGG - Intergenic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150847280 17:68672283-68672305 AGGTTTGGGAACAGGGAATAAGG + Intergenic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1203167025 17_GL000205v2_random:106846-106868 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1153530266 18:6039022-6039044 GGGTTGGGGAAGAGGGAGGAAGG - Intronic
1154348668 18:13565291-13565313 CTGTCTGGGATCAGGGAAGATGG - Intronic
1155168783 18:23251653-23251675 CAATTTAGAAAGAGGGAAGGAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1156955316 18:42955836-42955858 GAGCTTGGAAAGAGGGAACAAGG - Intronic
1157079110 18:44502549-44502571 GAATTTGCTAAGAGGGAAGAAGG - Intergenic
1157249858 18:46085387-46085409 CACTTTGAGAGGTGGGAAGATGG + Intronic
1157534475 18:48448240-48448262 CAGATTGGCAAGGGGGAAGTCGG - Intergenic
1157826841 18:50819955-50819977 CAGGCTGGCATGAGGGAAGAAGG - Exonic
1158335493 18:56411876-56411898 TGGATTGGGAAGAAGGAAGACGG - Intergenic
1158579520 18:58669701-58669723 CAGTTTGGGTAGAGGATGGAGGG + Intergenic
1158845731 18:61440776-61440798 GAGATGGGGAAGAGGGAACATGG + Intronic
1159693847 18:71528133-71528155 CAGTATGGAAAGAGAGAAAACGG - Intergenic
1159868009 18:73728815-73728837 CAGCTTTGGCAGAGGGGAGAGGG + Intergenic
1160091199 18:75828121-75828143 CACTTTGGGGCAAGGGAAGAAGG - Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161638104 19:5401918-5401940 AGGGTTGGGAGGAGGGAAGAAGG + Intergenic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162174616 19:8822067-8822089 GAGGCTGGGAACAGGGAAGACGG + Exonic
1162402453 19:10454284-10454306 CAGTTTGGAAAAAGGGAACGTGG - Intronic
1162706989 19:12562451-12562473 CAAGTTGGGAAGAGGGCATAGGG - Intronic
1162866630 19:13552875-13552897 CAGGTAGGGAAGAGGGAATGGGG - Intronic
1163678993 19:18669830-18669852 CAGCTTGGGATGGGGGAAGGAGG - Exonic
1163785762 19:19274161-19274183 CATTTCGGGGAGAGGGTAGAAGG + Intergenic
1163841502 19:19613708-19613730 GAGTTGGGAAAGGGGGAAGATGG - Intronic
1164696389 19:30247574-30247596 CACTTTGGGAAGTGGGAAGATGG + Intronic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1164886240 19:31780788-31780810 AAGTTTTGGAAGAGACAAGATGG + Intergenic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165483687 19:36082352-36082374 GAGATTGGGAAGAGTAAAGAGGG + Intronic
1166888557 19:45975585-45975607 GAGATGGGGAAGAGGCAAGACGG + Intergenic
1166909874 19:46146401-46146423 CAATTTTGGATGAGGAAAGATGG - Intronic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1168002393 19:53459521-53459543 AAGTTTGGGAAGAGGAATAATGG + Intergenic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168184755 19:54692577-54692599 AAGGGTGGGAAGAGGGGAGAGGG + Intronic
1168258427 19:55179672-55179694 AAAATTGGGGAGAGGGAAGAGGG - Intronic
1168259035 19:55182604-55182626 AGGTTTGGGAGGAGTGAAGAAGG - Intronic
1168593090 19:57652768-57652790 CAGCTAGGGAAAAGGGAACATGG - Intergenic
1168623451 19:57897532-57897554 TCTTTTGGGAAAAGGGAAGAGGG + Intronic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
926001856 2:9339733-9339755 CAGATAGTGAAGAAGGAAGAGGG - Intronic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
927220815 2:20707333-20707355 CAGTTGGGGAAGGAGGCAGAAGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
929465987 2:42144422-42144444 CAGATTCTGAACAGGGAAGAAGG + Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
930110632 2:47675803-47675825 CAGATGGGGAAGAAGGAAGGAGG + Intergenic
930270485 2:49250799-49250821 CGGTTTATGAAGAGAGAAGAAGG + Intergenic
930326283 2:49923053-49923075 TACTTTGGGAAGACTGAAGAAGG - Intronic
930345823 2:50179867-50179889 CAGTATAGGAAAAGGGAAGGAGG - Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930530799 2:52585924-52585946 CTGTTAGGGAAGAGGGCAGGTGG + Intergenic
930723477 2:54659913-54659935 CTGTTAGGGAAGAGGGGAAAAGG - Intronic
931178197 2:59874365-59874387 CAGTTTAGGAAAAGGCGAGAGGG + Intergenic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931579839 2:63760652-63760674 CAGCTTTGGAAAAGGTAAGAAGG - Intronic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932418691 2:71588721-71588743 CAGTTTGGGTAGTGGGCAGGAGG + Intronic
932468116 2:71936486-71936508 CACTCTGGGAAGAGGGTGGATGG - Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
932887690 2:75561706-75561728 AAGCTTGGACAGAGGGAAGACGG + Intronic
933000594 2:76917614-76917636 CAGTATGGGAAGAGTGAATTTGG - Intronic
933689437 2:85168398-85168420 AAGTGTGGGAACAGTGAAGATGG + Intronic
934151872 2:89154830-89154852 TAGTTTTGGAAGAGAGAAAAAGG + Intergenic
934215387 2:90027076-90027098 TAGTTTTGGAAGAGAGAAAAAGG - Intergenic
934925150 2:98377039-98377061 GAGTTTGGCAAAAGGGACGAGGG + Intronic
935534644 2:104279883-104279905 CAGATTTGGAAGAGGAAAGAGGG - Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937010144 2:118555542-118555564 CAGGTGGGCAAGAGGAAAGAAGG + Intergenic
938299308 2:130198853-130198875 CTGGGTGGGAACAGGGAAGAGGG - Intergenic
938457407 2:131475684-131475706 CTGGGTGGGAACAGGGAAGAGGG + Intronic
938580480 2:132641424-132641446 CAGTTGGGGGAATGGGAAGAGGG + Intronic
938872961 2:135500614-135500636 ATGATTGGGAAGAGGCAAGAGGG + Intronic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
938973796 2:136456502-136456524 CAGAATGGGAAGGGGGAAAAGGG + Intergenic
939260911 2:139807525-139807547 GAGTTTGTGAAAAGAGAAGAAGG + Intergenic
939535379 2:143421414-143421436 CAGGGTGGGAAGAGAAAAGAAGG + Intronic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939567120 2:143798276-143798298 CAGTTTGGGAAGGGGAAAAAAGG + Intergenic
939907573 2:147936299-147936321 AAGATGGGGAAGATGGAAGAAGG - Intronic
941903927 2:170703298-170703320 TGGTTTGGAAAGTGGGAAGAGGG - Intergenic
941917334 2:170821434-170821456 CAGGTTGGGAAGAGGGGCCAGGG + Intronic
942452072 2:176114647-176114669 CTTTTTGGGAAGAGGGACAAAGG + Intronic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942803053 2:179898231-179898253 CTGTTTGGAAAGAGTGAAAATGG - Intergenic
942990508 2:182195352-182195374 CAGGATGGGAAAAGGTAAGAAGG + Intronic
943049803 2:182900894-182900916 AAGATAGGGAAAAGGGAAGAAGG - Intergenic
944148983 2:196537305-196537327 CAGGGTGGGAGGTGGGAAGATGG + Intronic
944297268 2:198080522-198080544 CAGGTTGGGAGGAGGGGAGATGG - Intronic
944359218 2:198832298-198832320 CGATTTGGGAAGAGGTAATAGGG - Intergenic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
944546600 2:200805115-200805137 CAGATGGGGAAGAGGGAGGTAGG - Intergenic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946160244 2:217831431-217831453 TGAGTTGGGAAGAGGGAAGATGG - Intronic
946737957 2:222773475-222773497 CTTTTTGGGAGGAGGGGAGAGGG - Intergenic
946836047 2:223773796-223773818 GAGTAAGGGAATAGGGAAGAGGG + Intronic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947459461 2:230290667-230290689 CAGTTTGGCTTGAGGGAAGGAGG + Intronic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947544452 2:231001155-231001177 CTTTTTGGGAAGAGGAAGGAAGG - Intronic
947544693 2:231002554-231002576 GAGTTTGGAGAGGGGGAAGATGG + Intronic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948297121 2:236869081-236869103 CAGTTTGGAAGGAGGGGAAAGGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948797383 2:240411944-240411966 CAGGTTGCCAAGAGGGAATAGGG + Intergenic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1170098478 20:12672701-12672723 GAGTTTGGGAAGAGCTCAGAAGG + Intergenic
1170195589 20:13686094-13686116 CAGTTGGGGAATATGGATGAAGG + Intergenic
1170438069 20:16350542-16350564 AAGGTGGGGAGGAGGGAAGATGG + Intronic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170771853 20:19339825-19339847 CACATTGGGTAGAGAGAAGAAGG + Intronic
1171322699 20:24260415-24260437 CAGTATGGGGAGAAGAAAGATGG - Intergenic
1171335218 20:24379431-24379453 GAGTTTGGCAAGAGGCAAGAAGG - Intergenic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172744225 20:37194203-37194225 CTGTGTGGGAAGAGAGAAGGTGG + Intronic
1173155803 20:40607624-40607646 CAGTCTGGGAACATGGTAGAAGG - Intergenic
1174707945 20:52676293-52676315 AAGTTTGGGGAGAGGCAAGAAGG - Intergenic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176067573 20:63206485-63206507 CACCTTGGGTAGAGGGAAGCTGG - Intronic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1176334542 21:5583714-5583736 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176393215 21:6237234-6237256 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1176468204 21:7078940-7078962 CAGGTTGGCAGGAGGGTAGAAGG + Intronic
1176491765 21:7460718-7460740 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176508877 21:7677665-7677687 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1177277443 21:18931381-18931403 CAGTATGGAAAGAGAGAAGCAGG + Intergenic
1177343427 21:19835923-19835945 GAGTTGGGGAAGAGAGTAGAGGG - Intergenic
1177570456 21:22879243-22879265 CATTTTGGGAATTGGGAAGGAGG - Intergenic
1178317180 21:31576412-31576434 TAGTTTGGGAGGAGGGGAGGAGG + Intergenic
1178378856 21:32091901-32091923 CAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1179386001 21:40942450-40942472 GAAATTGGGATGAGGGAAGAGGG + Intergenic
1179474314 21:41633495-41633517 CTGCTGGGGAAGAGGAAAGAGGG + Intergenic
1179580453 21:42340150-42340172 CAGTATGGGTTGAGGCAAGAAGG - Intergenic
1179711995 21:43268810-43268832 CGGGTTGGGGAGAGGGAAGACGG + Intergenic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180429260 22:15231200-15231222 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1180911014 22:19449943-19449965 GAGTTGGGGAGTAGGGAAGAAGG + Exonic
1181160595 22:20957560-20957582 CAGCTTGGGATGGGGGTAGAGGG + Intergenic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1181676456 22:24456921-24456943 CAGGTTGGGAGGAGGCAGGAGGG + Intergenic
1181911463 22:26241649-26241671 CTGTTTGGGAAGAAGGCAGGAGG + Intronic
1181948239 22:26535530-26535552 CACTTTGGGAAGAGTGAAGCAGG + Intronic
1182528988 22:30940916-30940938 CAGCTTGGGAGGAGGCAGGAAGG - Intronic
1182536742 22:31009368-31009390 CAGTATGGAAATAGGGAAGAAGG + Intergenic
1182803672 22:33052461-33052483 CTGTTTGGGAGGAGGAAAGGAGG + Intronic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183414044 22:37672611-37672633 CAGCCTGGGAAGAGACAAGAAGG + Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1184203329 22:42984475-42984497 CAGTCTGGGGAGATGCAAGATGG - Intronic
1184502110 22:44880530-44880552 TAGTTTGGGAGGAGGGGAGCAGG - Intergenic
949606240 3:5657455-5657477 AAGTCAGGGAAGAAGGAAGAAGG - Intergenic
950335570 3:12190250-12190272 CAGTGTGGGAACAAGGGAGAAGG - Intronic
950453100 3:13076509-13076531 GCATTTGGGAAGAGGGAGGACGG + Intergenic
950656251 3:14438706-14438728 CAGTTTGGGATGGGAGAAGCAGG + Intronic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
952522735 3:34178383-34178405 CAGCTTTGGCAGAGTGAAGAAGG + Intergenic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
953025427 3:39142268-39142290 GCCTTTGGGAAGGGGGAAGATGG + Exonic
954425852 3:50442775-50442797 CAGCTGGGGTAGAGGGAGGAGGG + Intronic
954581155 3:51703571-51703593 CAGTCAGGGTAGAGGGCAGAGGG + Intronic
954675337 3:52312287-52312309 CAGGTTGGGAAGAGAACAGACGG + Intergenic
954683927 3:52360435-52360457 CAGTGTGGGAAGGAGCAAGAGGG - Intronic
954916122 3:54149786-54149808 AAGTTTGGTTAGGGGGAAGACGG + Intronic
955037329 3:55281918-55281940 AAGTTTGGGCAGATGGAAGGAGG - Intergenic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
956530487 3:70212345-70212367 CAGTTTGGGGAGAAGAATGAGGG - Intergenic
956912188 3:73829494-73829516 TAGTTTGGGTAGAGAGATGATGG - Intergenic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
957179434 3:76857940-76857962 CATTTTAGGAAGAGGGAATCGGG - Intronic
957262973 3:77923636-77923658 CATCTTGGGAAGAAGGAAGGAGG - Intergenic
957499849 3:81040719-81040741 CAGTTTGGGTAGGGGAAAGGAGG - Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
958053331 3:88377245-88377267 AAGTTTGGGAAGAATGATGATGG - Intergenic
958669805 3:97188908-97188930 CAGTTTGGGATTAGGGAAAGAGG + Intronic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960564206 3:119116979-119117001 CAGTTTGGGAAAAGGGGTGGGGG - Intronic
960591409 3:119369271-119369293 CAGTTGGCAAAGAGGGATGAGGG + Intronic
960783410 3:121345865-121345887 CAGTTTGGGATTAGGGAAGGAGG - Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961587992 3:127950272-127950294 CAGGGAGGGAAGTGGGAAGAAGG + Intronic
962010208 3:131384215-131384237 AAGTTTGGGCAGAGGGAACCAGG + Intronic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962949642 3:140205951-140205973 CTTTTTGGGAATAGAGAAGATGG - Intronic
963020103 3:140864531-140864553 AGGTTTGGGAAGAGGCATGATGG - Intergenic
963357877 3:144232916-144232938 AAGATTGGGAGGAGGGAAGGAGG + Intergenic
963706393 3:148693375-148693397 AAGTTTCTGAAGAGAGAAGAGGG - Intergenic
964726894 3:159822904-159822926 CTGTTTGGCAAGAGGGAGGTGGG + Intronic
966540510 3:181085081-181085103 GAGTTTGGGAAGGGGAGAGAGGG - Intergenic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
966740385 3:183227349-183227371 AAGTCTGGGAGGTGGGAAGAAGG + Intronic
966889648 3:184397790-184397812 CAGTCTGGAAAAGGGGAAGAAGG + Intronic
967378392 3:188830660-188830682 CACTTAGGAAATAGGGAAGAAGG + Intronic
967642594 3:191883832-191883854 TAGTTTGTGTAGAGAGAAGAGGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
970740932 4:19236855-19236877 GAGTCAGGGAAGAGGAAAGAAGG + Intergenic
971218838 4:24686638-24686660 CACTTTGGGAGGTGGGCAGATGG + Intergenic
971359449 4:25923238-25923260 CAGTTAGGGAAGAGTACAGATGG + Intronic
972571264 4:40312446-40312468 CATCCTAGGAAGAGGGAAGATGG - Intergenic
972646228 4:40970126-40970148 GAGATGGGGAAGAGGGATGAGGG + Intronic
974206889 4:58715601-58715623 CTGTTTGGGAAGAATGAATATGG - Intergenic
975168306 4:71203061-71203083 GTGTTTGGGAAGAGTGAATATGG + Intronic
975973919 4:80073333-80073355 CAGATTTGGGAAAGGGAAGAAGG + Intronic
976069302 4:81223045-81223067 CAGATTGGGAGGAGCAAAGAGGG + Intergenic
976572200 4:86625382-86625404 AAGGTTGGGATGAGGGAGGAGGG - Intronic
976818297 4:89175404-89175426 AGGTTGGGAAAGAGGGAAGATGG - Intergenic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
978305684 4:107325862-107325884 TACTTTGGACAGAGGGAAGAGGG + Intergenic
978315207 4:107427848-107427870 CACCTTGGGTAGAGGAAAGAAGG + Intergenic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
978903548 4:113980339-113980361 AAGTTAGGGGAGAGGTAAGAGGG - Intergenic
978998419 4:115184793-115184815 CAGTTTTGGTAGGGGGAGGAGGG + Intergenic
979248179 4:118533640-118533662 AAGTTTTGTAAGAGGAAAGAGGG - Intergenic
979745620 4:124209326-124209348 CACTTTGGGAAGAGAAATGAGGG + Intergenic
979752960 4:124302327-124302349 CATTTTGGGAAAATGGAAGAAGG - Intergenic
981056427 4:140366868-140366890 GCGTTTGGCAAGAAGGAAGAAGG + Intronic
981873972 4:149518904-149518926 CACTTAGGGAAGAGGTAAAAAGG + Intergenic
982196274 4:152918630-152918652 CAGTTTGGGAAGAAGAGGGATGG - Intergenic
984298223 4:177881289-177881311 CAGTTTGTGGAGGGGGAAGCAGG + Intronic
985326656 4:188778135-188778157 CATTTTGCAAAGAGGGAACATGG + Intergenic
985421242 4:189787050-189787072 GATTTGGGGAAGAGTGAAGACGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985883120 5:2655899-2655921 CAGTTTGGAAGGAGAGATGATGG + Intergenic
985935112 5:3091694-3091716 AAGTTTGGAAAGAAAGAAGATGG + Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
987172161 5:15270239-15270261 TATTTTGGGAGGAAGGAAGAGGG - Intergenic
987203962 5:15605642-15605664 CATTTTGGAAATAGTGAAGATGG + Intronic
987384679 5:17318049-17318071 TAGTTTGGGAGGAGAAAAGATGG + Intergenic
987615426 5:20267942-20267964 GAGAGTGGGAAGAGGGAAGGAGG - Intronic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
988806062 5:34741807-34741829 TGGCATGGGAAGAGGGAAGAGGG + Intronic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
991631656 5:68662133-68662155 GAGTTTGGAAAGAAGAAAGAGGG + Intergenic
991666651 5:69006144-69006166 CAGGCTGGGATGAGGGAAGGAGG + Intergenic
992562340 5:77965044-77965066 CAGGTTGGGGTGAGGAAAGAAGG - Intergenic
993605637 5:89987557-89987579 CACCTTGGGCAGAGGGCAGAGGG + Intergenic
993996481 5:94729515-94729537 GAGACTGGGAAAAGGGAAGAAGG - Intronic
994911169 5:105910179-105910201 CAGTATGTGAATAGGGAATAGGG - Intergenic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
996003528 5:118392452-118392474 GACTTTGTGAAGAGGGAAGATGG - Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997619557 5:135276937-135276959 CTGTTTGGAAAGATGGCAGATGG - Intronic
997641739 5:135452877-135452899 CAGTTTGGAAGGGGTGAAGATGG + Intergenic
997644194 5:135469234-135469256 CAGTTTGGAAGAAGAGAAGAGGG + Intergenic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
998408530 5:141889086-141889108 GAGTTTGGGAAGGGGGCAAAGGG - Intergenic
1000435892 5:161208467-161208489 CACTTTGGGAAGACTGAAGTGGG + Intergenic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001406876 5:171482736-171482758 AAGTTTGGGATGAGTGGAGATGG - Intergenic
1002108303 5:176891241-176891263 GAATTTGGGAAGTGGGCAGAGGG - Intronic
1002995679 6:2282364-2282386 TAGCTTGGGAAGAGAGAAAAGGG + Intergenic
1003020929 6:2508827-2508849 TATTTTGGGGAGAAGGAAGAGGG + Intergenic
1003518953 6:6841464-6841486 AAGTTTAGGAAGAATGAAGAAGG + Intergenic
1003528968 6:6921743-6921765 CAGTTTGGGGATATGGAAGGAGG + Intergenic
1004295992 6:14411348-14411370 CAATTGGGGAAGAGTGAATATGG + Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005946768 6:30601445-30601467 CAGCTGGGGAAAAGGGAAAATGG + Exonic
1007067079 6:39001621-39001643 GAGTGTGGGAAGAAGAAAGAAGG + Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008379854 6:50828832-50828854 CATGTTGGGAAGATGGAAGTTGG + Intronic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1008492525 6:52101279-52101301 CAGGTTTGGAAGACGGAGGAGGG - Intergenic
1009480104 6:64146521-64146543 CAGCAGGGGAAAAGGGAAGAAGG + Intronic
1009527722 6:64767415-64767437 GAGTATGGGGAAAGGGAAGATGG - Intronic
1009680788 6:66889658-66889680 CATTTTGGGGGGAGGGGAGAGGG + Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012494280 6:99817222-99817244 CAGCATGGAAAGAGGGAAAAAGG - Intergenic
1012644500 6:101661913-101661935 CACTTTGGTAACTGGGAAGATGG - Intronic
1012814445 6:104004331-104004353 TTCTTTGGGAAGAGGGGAGAAGG + Intergenic
1013416698 6:109931977-109931999 AAGCTGGGGAAGAGGGAAAATGG + Intergenic
1014047686 6:116912179-116912201 CTGCTGGGGAAGGGGGAAGAGGG + Intronic
1014250538 6:119111403-119111425 CAGTTGGGGAAGATGAAAAACGG + Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015744817 6:136498644-136498666 GAGTTTGGAAAAATGGAAGATGG + Intronic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016053356 6:139553249-139553271 CAGCTTGAGAAAAGGAAAGAGGG + Intergenic
1016488220 6:144566789-144566811 CAGTTTGAGAAGCTGGAATAAGG - Intronic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1018238888 6:161753420-161753442 CAGGTTGGAAAGAGAGAAGAAGG + Intronic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1019367430 7:642012-642034 CACTTGGGGAGGAGGGAGGAGGG - Intronic
1019783523 7:2958876-2958898 GAGATGGGGAGGAGGGAAGATGG + Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1021803655 7:24333422-24333444 AAGTTGGGGAAGATGGAAGGGGG + Intergenic
1022026060 7:26448911-26448933 CAGTCTGTGAAAAGGCAAGACGG + Intergenic
1022203456 7:28139931-28139953 TATTTGGGGAACAGGGAAGAAGG + Intronic
1023771486 7:43560595-43560617 TATTTTGGGAATAAGGAAGATGG - Intronic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1026808622 7:73443861-73443883 AAGTTTGGTAAGAAGGAGGAGGG + Intronic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1026891447 7:73985194-73985216 CAGCTCGTGAAGAGGGAAGGTGG + Intergenic
1027421979 7:78025726-78025748 AAGTTTGGGGAGAGGGAACAAGG + Intronic
1028308424 7:89296760-89296782 CAGTTTAGGGAGAGGAAAGGTGG - Intronic
1028564516 7:92213940-92213962 CAGTTTGGTAACAGGTACGATGG + Exonic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028968333 7:96827788-96827810 AAGTGTGGGAAGTGTGAAGAGGG - Intergenic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1029944668 7:104519518-104519540 CAGTTTAGGGAGGGAGAAGAAGG + Intronic
1029984966 7:104914590-104914612 CAATTTGCGGAGAGGGCAGAGGG + Intergenic
1030504734 7:110406965-110406987 CAGTTTGGTGAAAGGCAAGAAGG - Intergenic
1031953744 7:127920560-127920582 CAGTTTGGGATGAGGTAGGGAGG + Intronic
1032317511 7:130853216-130853238 TAGGATGGGAAAAGGGAAGAAGG + Intergenic
1032414646 7:131726693-131726715 GAGACAGGGAAGAGGGAAGAGGG + Intergenic
1032587535 7:133161272-133161294 CAATTTGGGAAGAGTGATGAGGG + Intergenic
1032694447 7:134322255-134322277 CATTTGGGGAGGAGGGGAGAGGG - Intergenic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1035780505 8:2223831-2223853 CAGTTAGGGTCGAGGGAAGCTGG - Intergenic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1037346374 8:17905618-17905640 CATTTTGAGAAGAGGGAAAGAGG + Intronic
1037563286 8:20094345-20094367 GAGTCTGGGAAGAGTGAAGCAGG + Intergenic
1038155439 8:24985082-24985104 CAGTCTAGGAAAAGGGAACAGGG + Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038775461 8:30526751-30526773 AAATTTGGGAAGAAGGAAGAAGG + Intronic
1039824059 8:41158012-41158034 GAGTTTGGAAAGAGTGAGGAAGG - Intergenic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1041570791 8:59335008-59335030 CAGTTTGGGGAGAAGGAATTTGG - Intergenic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1042579643 8:70262689-70262711 CAATGTGGGAGGAGGCAAGAAGG + Intronic
1042750558 8:72153448-72153470 CAGCTTGGGAGGAGCCAAGATGG - Intergenic
1044217058 8:89624657-89624679 GGGTTTGGGAGGAGGGAAGGAGG - Intergenic
1044828829 8:96225080-96225102 AGGTTTGGGAAGGGGGAAGAGGG + Intergenic
1044884979 8:96767394-96767416 CGGCTTGGGAAGAGGACAGAGGG - Intronic
1044999890 8:97869685-97869707 CAGGTTCCGAAGAGGGAAGGGGG - Intronic
1045233291 8:100326700-100326722 AGGTCTTGGAAGAGGGAAGAAGG - Intronic
1046545732 8:115648164-115648186 CAAGTTGGGAAGTGGGGAGAAGG + Intronic
1046748770 8:117904789-117904811 AAGGTTGGGGAGAGGGAAGTAGG + Intronic
1047358420 8:124144940-124144962 AAGTGTGGGAAAAGGGAGGATGG + Intergenic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047681699 8:127260188-127260210 CATTTTGGGAGAAGGGAAGGAGG - Intergenic
1047724246 8:127670465-127670487 GAGTTGGGGAAGAGGAAAGGGGG - Intergenic
1048867120 8:138769418-138769440 CTCCTTGGGAAGGGGGAAGATGG + Intronic
1050714277 9:8504044-8504066 CAGTGTAGGAAGTGGGAAGGTGG + Intronic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1053100852 9:35371192-35371214 GAAATGGGGAAGAGGGAAGAGGG - Intronic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1054140709 9:61527310-61527332 CAGTTAGACAAGAGGAAAGAAGG - Intergenic
1055299179 9:74865249-74865271 CAATTTGGAAAGAGGAAGGAAGG - Intronic
1055437874 9:76310628-76310650 AATTCAGGGAAGAGGGAAGATGG - Intronic
1057231581 9:93324662-93324684 GAGGCTGGGGAGAGGGAAGAGGG + Intronic
1057236508 9:93365955-93365977 GAGGCTGGGGAGAGGGAAGAGGG - Intergenic
1058149096 9:101444269-101444291 CAGTTAGGGCAGAGGGAATGGGG + Intergenic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1058969344 9:110065708-110065730 GAGCTGGGGAAGAGGAAAGAAGG - Intronic
1059341439 9:113599731-113599753 GAGGTTGGGAAGGTGGAAGAGGG - Intergenic
1060059543 9:120446771-120446793 CATCTTGGGAAGAAGGAAGAAGG - Intronic
1060130001 9:121087168-121087190 GAGTATGGGACAAGGGAAGAGGG + Intronic
1060214565 9:121731017-121731039 CAGTTTGGGAGCAGGGAATCAGG - Intronic
1060240235 9:121896932-121896954 CAGTTTGGGAAGCGGTCATAAGG - Intronic
1061081536 9:128373712-128373734 CAACTTGGGAAGGAGGAAGAGGG - Intronic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061642097 9:131966933-131966955 CAGCTAGTGAAGAGTGAAGATGG - Intronic
1062060025 9:134490260-134490282 CAGTTTGGGAAGGTTGAAGAGGG + Intergenic
1062729287 9:138100177-138100199 GAGGTGGGGCAGAGGGAAGAGGG + Intronic
1203427089 Un_GL000195v1:51204-51226 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1203439113 Un_GL000195v1:171861-171883 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1186623454 X:11266111-11266133 GAGTTGGGGAGGAGGAAAGAGGG + Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187432432 X:19237313-19237335 AAGCTTGGGAAGAGAGAATAGGG - Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189204603 X:39226932-39226954 CAGTTTGAGAAGAAGGGAAAAGG + Intergenic
1189209085 X:39267654-39267676 CAGTTTGGGAGGAAAGATGATGG - Intergenic
1189475264 X:41347960-41347982 CAGTTTGGGATGGGGGTAGGCGG - Exonic
1189539761 X:41973556-41973578 CAGGTTGGGAAGAGGGATTTTGG + Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190315111 X:49145710-49145732 CAGCTTGGGAACAGGTAGGAGGG + Intergenic
1192244580 X:69361872-69361894 AAGATTGGGAAGTGGGAAGCGGG + Intergenic
1192333474 X:70199127-70199149 GGGTTGGGGAAGAGGGGAGAAGG + Intronic
1192743440 X:73915298-73915320 CAGGATGGGAAGTGGGGAGAGGG + Intergenic
1193530932 X:82653032-82653054 CAATTTGGGAAGTGGGCAGAGGG + Intergenic
1193787509 X:85777681-85777703 CAGTTTGGGAAATGTGCAGATGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195549956 X:106157173-106157195 GAGATTGGGAAGGTGGAAGAAGG + Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1199743806 X:150759300-150759322 TATTTTGGCAACAGGGAAGATGG + Intronic
1199773383 X:150989564-150989586 CAGGTTGGGGTGAGGGGAGATGG + Exonic
1202062230 Y:20899660-20899682 CAGTTTTTGAATAGGGAAAATGG - Intergenic