ID: 968348444

View in Genome Browser
Species Human (GRCh38)
Location 3:198031592-198031614
Sequence AAATGCTTTCAGAATTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 2, 2: 17, 3: 84, 4: 591}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968348444 Original CRISPR AAATGCTTTCAGAATTCTGA TGG (reversed) Intronic
900559292 1:3295751-3295773 GAATTCTTCCAGAATTCTGTAGG + Intronic
901291582 1:8128492-8128514 AAATGCTAACAGAAATCTGGGGG - Intergenic
901948925 1:12725950-12725972 TAATGCACTCAGAATTCTCATGG - Exonic
903036670 1:20497522-20497544 AATTTCATTCAGAATTCTAATGG - Intergenic
903044583 1:20555118-20555140 AACTACTTTCAGGTTTCTGATGG - Intergenic
904205362 1:28851292-28851314 CCATGCCTTCAAAATTCTGATGG + Intronic
904224252 1:29001643-29001665 ATTTGCCTTCAGAATTTTGAAGG + Intronic
904224253 1:29001648-29001670 CAATGCCTTCAAAATTCTGAAGG - Intronic
905223538 1:36465084-36465106 AAATGCTCTCAGAAAAGTGAGGG - Intergenic
905413228 1:37786553-37786575 AATTTCTTCCAAAATTCTGAGGG - Intergenic
905685893 1:39907920-39907942 AAGTACTTTTAGAATTCTCAGGG - Intergenic
906172185 1:43735698-43735720 AAATTATCTCAGAGTTCTGAAGG - Intronic
906329645 1:44874613-44874635 AAATGCCTTCAAAATTCTGAAGG - Intronic
906358264 1:45128080-45128102 AAATCTTTCCAGAATTTTGATGG - Intronic
907418893 1:54333207-54333229 AAATCCTTTCCGTATTCTGTGGG - Intronic
907492611 1:54818021-54818043 AAAGGCCTTCAAAATTCAGAGGG - Intronic
907607557 1:55833391-55833413 AAAAGCTTCCAGAATCCTGTTGG - Intergenic
908518446 1:64917234-64917256 CAATGCCTGCAAAATTCTGAAGG + Intronic
909473694 1:76058211-76058233 AAATGCTTTTAGACTGCTGTGGG + Intergenic
909650915 1:77974994-77975016 AGATGCTTTAAGTATACTGAAGG - Intronic
909744455 1:79076045-79076067 AAATGGTTTCAATATTCTGGGGG - Intergenic
909748744 1:79133080-79133102 TAATAATTTCAAAATTCTGAGGG + Intergenic
910394289 1:86776412-86776434 AAATGCATTGAGAATTTTTATGG - Intergenic
910455142 1:87389818-87389840 TAATGCCTTCAAAGTTCTGAGGG + Intergenic
910700506 1:90069131-90069153 AAAAGCTTTCAGAATTGCCAAGG + Intergenic
910810543 1:91231110-91231132 AAATAGTTTCTGAATTCTGGAGG - Intergenic
911037971 1:93570095-93570117 AGAAGCTTTCAGAATTCTTCAGG - Intronic
911208061 1:95112601-95112623 AAATGCTTTCAAAATGCTGAGGG + Intergenic
911307593 1:96250055-96250077 AAATGGTTTTAGGATTCTGATGG - Intergenic
911329325 1:96509007-96509029 AAAAGATTTTAGAATTGTGAAGG + Intergenic
911416924 1:97586619-97586641 AACTATTTTCAAAATTCTGAAGG - Intronic
911470769 1:98315696-98315718 AAATGCTTTCGAAATTCAAAAGG + Intergenic
911724627 1:101229870-101229892 TAATGCTTTCAAAATTCTCAGGG + Intergenic
911817388 1:102370125-102370147 AAATACTGTTAGAATTTTGAAGG + Intergenic
912396369 1:109347560-109347582 AAATGGTTTAAGACTGCTGAAGG + Intronic
913194647 1:116445377-116445399 TAATTCTTTCAGTGTTCTGAGGG + Intergenic
913665327 1:121042924-121042946 AAATGCTTCCTGACCTCTGAAGG - Intergenic
914016721 1:143826193-143826215 AAATGCTTCCTGACCTCTGAAGG - Intergenic
914161065 1:145134818-145134840 AAATGCTTCCTGACCTCTGAAGG + Intergenic
914655333 1:149734734-149734756 AAATGCTTCCTGACCTCTGAAGG - Intergenic
914789610 1:150865952-150865974 TAATGCCTTCAAAATTCTGAGGG - Intronic
915746277 1:158161200-158161222 AAATTCTTTCAGTATTCAGTTGG + Intergenic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
915863003 1:159467104-159467126 AAATGCTTTCTGCTCTCTGAGGG + Intergenic
917404355 1:174687388-174687410 AAATCCTTTTAGAATCCTTAAGG + Intronic
917429830 1:174954560-174954582 ATATGGTTTCAGAATTCTCTAGG + Intronic
917433446 1:174995647-174995669 AGTTGCTTTCAGAGTCCTGATGG - Intergenic
917773895 1:178312382-178312404 GAATGCCCTCAAAATTCTGAAGG + Intronic
917773896 1:178312387-178312409 AATTTCCTTCAGAATTTTGAGGG - Intronic
918994329 1:191736814-191736836 AATTGCTGTTAGAATTTTGATGG + Intergenic
919269914 1:195327119-195327141 AAATCCTTTTATAAATCTGAAGG + Intergenic
919348685 1:196419687-196419709 CAATGCTTTCAAAATTCTGAAGG - Intronic
919484859 1:198133497-198133519 TAATGCCTTCACAATTATGAAGG + Intergenic
919680807 1:200432647-200432669 AAATGCCTTTATAATTCTGAGGG - Intergenic
919765083 1:201121989-201122011 CAATCCTTTCAGAATCTTGACGG + Intronic
920627209 1:207613773-207613795 GAATGATTTCAGATTTCAGAAGG + Intronic
920786479 1:209047157-209047179 AAGTGCTTTAAAATTTCTGAAGG + Intergenic
920909542 1:210202606-210202628 AAATGCATTCTGAATTATCAAGG + Intergenic
921103593 1:211953328-211953350 AAATGTTTTCAGAAATTTGCAGG - Intronic
921166197 1:212509039-212509061 AAATGCCTTCAAAATTCTGAAGG - Intergenic
921398135 1:214690654-214690676 TAGTGCTTTCATAAATCTGAAGG + Intergenic
921681617 1:218039745-218039767 AAATAATTTCACATTTCTGAAGG - Intergenic
922192859 1:223334662-223334684 TAATGCCTTCAAAATTATGAGGG + Intronic
923069278 1:230547979-230548001 AAATGTTCCCAGAATTGTGAAGG + Intergenic
923477925 1:234354380-234354402 AAATGCCTTCAAAATTCTGGGGG + Intergenic
923739000 1:236638443-236638465 CCCTGCTTTCAGAATTCTGGGGG + Intergenic
923970842 1:239201699-239201721 AAATTCTTTGATAATTCTGATGG + Intergenic
924279382 1:242420791-242420813 AAGAACTTTCAGAGTTCTGATGG - Intronic
924656780 1:245979661-245979683 AATTTTTTTCACAATTCTGAGGG - Intronic
1063280359 10:4622413-4622435 AAATGCTTTTAGAAGTAGGAAGG - Intergenic
1063446651 10:6122314-6122336 CAATGCCCTCAAAATTCTGAGGG - Intergenic
1063837902 10:10036770-10036792 AATTCCTTTAATAATTCTGAAGG + Intergenic
1064855305 10:19760670-19760692 TTATGCTTTCAGAGTTCTGGAGG - Intronic
1065717674 10:28588415-28588437 AACTGCCTTCAGAATTATTAGGG + Intronic
1065910614 10:30300937-30300959 CAATGCCTTCAGAGTTCTGGTGG - Intergenic
1067298541 10:44990005-44990027 TAATTCTTTCAGGATTCTGAAGG + Intronic
1067492439 10:46723852-46723874 TCTTGCTTTCAAAATTCTGAAGG + Intergenic
1067602227 10:47616542-47616564 TCTTGCTTTCAAAATTCTGAAGG - Intergenic
1067730078 10:48804232-48804254 AAATACATTCAAAATGCTGAAGG - Intronic
1068891397 10:62151615-62151637 GAATGCTTACACAATTCTGGTGG - Intergenic
1068907356 10:62341799-62341821 AAAAGCTTTCAGGACTCTCATGG - Intergenic
1070304207 10:75228772-75228794 CTTTGCTTTCAGCATTCTGAGGG - Intronic
1070344562 10:75529312-75529334 TTTTCCTTTCAGAATTCTGAAGG - Intronic
1070840357 10:79482680-79482702 GAATGCCTTCAAAATTTTGAGGG + Intergenic
1070941539 10:80352812-80352834 ACATGGTTTCAAAATCCTGAAGG + Intronic
1070941670 10:80353871-80353893 ACATGGTTTCAAAATCCTGAAGG - Intronic
1071134853 10:82441739-82441761 AATTACTTTGAAAATTCTGAGGG + Intronic
1071260560 10:83915485-83915507 AAATGCTTCCAGAGCTCAGAAGG + Intergenic
1073824513 10:107304825-107304847 AAATGCTTTCAGCATTCTCTGGG + Intergenic
1073991480 10:109267044-109267066 AGATGCTCAGAGAATTCTGAAGG + Intergenic
1074284653 10:112086707-112086729 AAATGCCTTTAAAATACTGAGGG + Intergenic
1075188981 10:120288730-120288752 AAATGCTTTAAGCATTTAGAGGG + Intergenic
1075662682 10:124209139-124209161 AGCTGCTATCAAAATTCTGAAGG + Intergenic
1075920241 10:126205307-126205329 ACATACTTTCAGAATTCTTTTGG - Intronic
1076415933 10:130288574-130288596 AGATGTTTTGGGAATTCTGAGGG + Intergenic
1077482601 11:2823272-2823294 AGATGCCTTCAAAATTGTGAAGG + Intronic
1077483736 11:2828965-2828987 AAATGCCTTCAAACATCTGAGGG + Intronic
1077791959 11:5450547-5450569 ATATGGTTTCAGAAATCTCAAGG + Intronic
1077840272 11:5966792-5966814 AGATGGTGTCAGAAATCTGATGG + Intergenic
1079695016 11:23471115-23471137 ATAAAATTTCAGAATTCTGATGG + Intergenic
1079796576 11:24811247-24811269 TAAGGCTTGCAGGATTCTGAGGG - Intronic
1080229533 11:30003532-30003554 AATTTCTTTCTGAAATCTGATGG + Intergenic
1080405636 11:31976418-31976440 AAATGATTTAATACTTCTGAGGG + Intronic
1081035485 11:38139314-38139336 AAATGCTATTTGAATTATGATGG - Intergenic
1081221090 11:40462929-40462951 AAATGATGTGAGAATTCTGGAGG + Intronic
1081545516 11:44068777-44068799 AACAGCTTTCTGACTTCTGAAGG - Intronic
1081942678 11:46957501-46957523 AAATGCTTTAAAAATTCTAAGGG - Intronic
1081996670 11:47369683-47369705 AAATGCTTTCCAATTTCTAAGGG + Intronic
1082753714 11:57050853-57050875 AAATAGTTTCATAATTCTTAAGG + Intergenic
1082926001 11:58548093-58548115 CAATGTCTTCAGAATTATGAAGG + Intronic
1083125474 11:60561275-60561297 AAATGCTTTCACAGTTTTGGTGG - Intergenic
1083475329 11:62911520-62911542 AAATGCTTTGAGAATTTGGCAGG - Intronic
1083489442 11:63004641-63004663 AAAATCATTCAGCATTCTGATGG - Intronic
1086104711 11:83134728-83134750 AAATTTTTTCAGAAGTCTCATGG - Intergenic
1086268405 11:85029051-85029073 AAAAGCTTTCAAAATTCTTGGGG + Intronic
1086499625 11:87438715-87438737 CAAAGCTTTCCCAATTCTGAGGG - Intergenic
1086947657 11:92859301-92859323 AAATCCCTGCATAATTCTGAAGG + Exonic
1087015450 11:93550285-93550307 AACTCCTTTCAGAATTTTGGGGG + Intergenic
1087104725 11:94398194-94398216 AAATGCTGTCAGGAGTGTGAAGG - Intronic
1087157977 11:94923147-94923169 AGGTGCTTTCTGAATTCTGTGGG + Intergenic
1087610325 11:100426441-100426463 AAATGCTTTCATACTTTTGGTGG + Intergenic
1087815809 11:102657357-102657379 AAATACCTTCAAAATTCTAAGGG + Intergenic
1088614222 11:111607351-111607373 AAAGGTTTTCAGAATTGTTAAGG + Intronic
1089207223 11:116773869-116773891 AAACGATTTGAGAATTGTGAGGG - Intergenic
1089896967 11:121940434-121940456 AAATACTTTCAGAAATGTGTAGG - Intergenic
1090594307 11:128304834-128304856 AAATGCTTTCTGTCTTCTGCTGG - Intergenic
1092087838 12:5778837-5778859 AAAGGCTTATAGAATTTTGATGG + Intronic
1092434778 12:8438922-8438944 AAATGATGTCAGAAAACTGAAGG - Intergenic
1092565227 12:9658450-9658472 AAATAGTTTCTGAATTTTGAAGG - Intergenic
1092571821 12:9733555-9733577 AATAGCTTTCAGAATTTTTAAGG - Intergenic
1092860518 12:12716288-12716310 GAATGCTTTCAGAGGGCTGAAGG - Intronic
1092932630 12:13331042-13331064 AAATGCCTTAAAATTTCTGAAGG + Intergenic
1093243858 12:16711375-16711397 AAAGGCTGTTACAATTCTGAAGG + Intergenic
1093918151 12:24829062-24829084 AAATGCTTACAAAATATTGAAGG + Intronic
1094243108 12:28252084-28252106 TAATGCTTTTAAAATTCTGGGGG - Intronic
1094602458 12:31921725-31921747 AAATGGTTTCCAAATTCTGAAGG - Intergenic
1095494503 12:42770411-42770433 AAAATGTTTCAGAATTCTCATGG + Intergenic
1095796727 12:46227148-46227170 CAATACCTTCAAAATTCTGAAGG + Intronic
1096190983 12:49619072-49619094 CAATGCCTTCATAATTCTGAAGG + Intronic
1096190984 12:49619077-49619099 GAATTCCTTCAGAATTATGAAGG - Intronic
1096472055 12:51885225-51885247 AAATGCAAACAGAAGTCTGATGG - Intergenic
1096998963 12:55859612-55859634 AATTTCTTTCAGAATTTTAAAGG - Intergenic
1097282978 12:57856685-57856707 CAATGTCTTCAAAATTCTGAAGG - Intergenic
1097459913 12:59848646-59848668 AAATTTTTTCAAAATTCTCAGGG - Intergenic
1098143369 12:67473334-67473356 AATCCCTTTCAGGATTCTGAAGG - Intergenic
1098554887 12:71807300-71807322 AAATGCTTTCAGAAAATTCATGG - Intergenic
1098658365 12:73061748-73061770 AAATGCTATTGGAATTTTGATGG - Intergenic
1099176045 12:79423474-79423496 AAGTACTTACAAAATTCTGAGGG - Intronic
1099202879 12:79695398-79695420 CAATGCCTTCAAAATTATGAAGG - Intergenic
1099541775 12:83918682-83918704 AAATGCTTTTAGAATAATAAAGG + Intergenic
1099746189 12:86707886-86707908 AAATGCTTTCAGTTTTATAAGGG + Intronic
1099864348 12:88260392-88260414 AAAAGACTTCAAAATTCTGAAGG + Intergenic
1100197494 12:92263778-92263800 AATTGTTTTCAAAATTCTAATGG + Intergenic
1100930523 12:99603639-99603661 AAATAGTTTCTGAATTCTGGAGG + Intronic
1100959903 12:99951041-99951063 CAATGCTTTCAAAATTCTGAGGG - Intronic
1101203410 12:102460643-102460665 AAATCCCTTAAGAAATCTGACGG - Intronic
1101962741 12:109262110-109262132 TAATGCTTTCTGAACTCTGGAGG - Intronic
1102362491 12:112300358-112300380 CAGTACTTTCAGAATTCTGAGGG - Intronic
1103748467 12:123142454-123142476 GAGTGCTTTCAGAATTCTTGAGG + Intronic
1104059995 12:125259583-125259605 AAATGCTCTAAGAATTGGGAGGG + Intronic
1104390275 12:128386132-128386154 AGTGGCTTTCAGAGTTCTGATGG - Intronic
1104568534 12:129904908-129904930 AAAAGCATTCAGAATTTTTAAGG + Intergenic
1105430443 13:20332634-20332656 GAATGCTTTGGGAATTCTGAGGG + Intergenic
1105524458 13:21163518-21163540 AAATGCTTTTATAATGCTGGTGG - Intronic
1106210231 13:27635764-27635786 CTATCCTTTCAGAATTCTTAGGG - Intronic
1106286480 13:28322350-28322372 TAATGCTTTCCAGATTCTGACGG - Exonic
1106354072 13:28962900-28962922 AAATGCCCTGAGAATTCTGATGG + Intronic
1106766604 13:32919681-32919703 AATCACTTTCAGAATGCTGAGGG + Intergenic
1107622251 13:42245091-42245113 AACTGCCTTCAGATATCTGAGGG + Intronic
1108085663 13:46789358-46789380 CAGTGCTTTCAGGATTCTGAAGG - Intronic
1108274921 13:48798162-48798184 AAATGCTTTCAAAATTCTGAAGG + Intergenic
1108278278 13:48834049-48834071 AAGTGCTTTCACAATTCTGTGGG - Intergenic
1108807752 13:54180736-54180758 AAATGGTTTCTGTATTCAGATGG + Intergenic
1109059875 13:57601779-57601801 AAATACTTTCAGAAACCTCAGGG - Intergenic
1109491481 13:63106201-63106223 AAGAGCTTTAATAATTCTGAAGG - Intergenic
1110118830 13:71855302-71855324 ATATGCTGTCACAATTATGATGG - Intronic
1110446635 13:75590444-75590466 AAATGAATTCAGAAAGCTGAAGG - Intronic
1110468906 13:75835327-75835349 AAATACTCACAGAACTCTGAAGG - Exonic
1111025241 13:82511915-82511937 CAATATTTTCAGATTTCTGAAGG + Intergenic
1111570799 13:90082622-90082644 TAATATATTCAGAATTCTGAAGG - Intergenic
1111809060 13:93075207-93075229 AAATCCTTTCAGAAATCTCTTGG - Intergenic
1112688040 13:101854637-101854659 AAAGTCATTCAGAATTCTCAAGG + Intronic
1113287116 13:108862438-108862460 AAAAGATTTCACAATTGTGAAGG + Intronic
1113845616 13:113388730-113388752 AAAAACTTTTAGAATTCTTATGG + Intergenic
1114152714 14:20063436-20063458 GAATGGGTTCAGAATTCTTATGG - Intergenic
1114921400 14:27335519-27335541 ACATCATTTCAGAATTCTGTCGG - Intergenic
1115120356 14:29929503-29929525 AATGCCTTTCTGAATTCTGAAGG + Intronic
1115168900 14:30480493-30480515 CAAGGCCTTCAAAATTCTGAGGG + Intergenic
1115270004 14:31540917-31540939 CAATGCTTTTAAAATCCTGAGGG - Intronic
1115489971 14:33949936-33949958 AAAAGCACTCAGAATTCTGGAGG - Intronic
1115631091 14:35246006-35246028 ATATTATTTCAGAATTTTGAAGG + Intronic
1115835068 14:37393233-37393255 AAATGCTCTCACATTTCTGGAGG - Intronic
1116023697 14:39491013-39491035 AAATGGTGTCTGAATTCTGAAGG + Intergenic
1116426028 14:44792361-44792383 CAATGTTTTCAATATTCTGAGGG + Intergenic
1116512089 14:45758287-45758309 AAAACCATTCAGGATTCTGATGG + Intergenic
1117033377 14:51699669-51699691 ATGTGCTTTGAGAATTCTTAAGG + Intronic
1117075182 14:52095267-52095289 AAATGGTTTCAGATTTATTATGG + Intergenic
1117078227 14:52125417-52125439 AAATGCTTTGGGAAATCTCAGGG - Intergenic
1118139052 14:63059714-63059736 AAATCCTTGCAGAGTTCTGTTGG - Intronic
1118216183 14:63810809-63810831 TAATACTTTCTGAATTCTGGAGG - Intergenic
1118499283 14:66343150-66343172 AAATGATTTGAGAGTACTGAAGG + Intergenic
1118540963 14:66824853-66824875 AAGTGATAGCAGAATTCTGATGG + Intronic
1118872135 14:69752327-69752349 AAATCCTTTCAGAAATCAAATGG - Intronic
1119779380 14:77268147-77268169 CAATGCTTTCCGATTTCTCATGG - Intronic
1120408977 14:84126970-84126992 AAATGCTTTCAGAATTGCAAAGG + Intergenic
1120599903 14:86490297-86490319 ATATGGTGTCAGAATCCTGAAGG + Intergenic
1120673888 14:87396216-87396238 AAATTCTTTCAAAATTATGATGG - Intergenic
1121160840 14:91738451-91738473 CAATGCTTTCAGAGTCCTAAAGG + Intronic
1121663766 14:95656026-95656048 CAATGCCTTCAAAGTTCTGAGGG - Intergenic
1121716651 14:96080849-96080871 AAGTGCTCTCTGAATTCAGAAGG - Intronic
1123692028 15:22846211-22846233 AATTGCTTTCAGAATTCCTTGGG + Intronic
1123824235 15:24065010-24065032 AAATCCTTTCAGGACTCTCACGG - Intergenic
1124147180 15:27138724-27138746 TTATGCCTTCAGAATCCTGAGGG - Intronic
1125053046 15:35323811-35323833 CATTGCTATCAGAATTCTGCCGG + Intronic
1125367623 15:38935466-38935488 TAATGCTTTCAAAATCTTGAGGG + Intergenic
1126774667 15:52090078-52090100 AAATGCCTCGAAAATTCTGAAGG + Intergenic
1127195513 15:56581466-56581488 GAATGCTTTCTGAATTTTGGAGG - Intergenic
1127337588 15:58004651-58004673 AAATGATTTCATAATTTTTATGG + Intronic
1127692733 15:61413910-61413932 CAGTGCTTTCAAAATTCTGAAGG + Intergenic
1128267847 15:66282198-66282220 TAATGCTTTGACAATTCTGGGGG - Intergenic
1128488835 15:68125614-68125636 TAATGCCTTCAAAATTCTAAAGG - Intronic
1129203397 15:74020064-74020086 AAATGCATTTGTAATTCTGATGG + Intronic
1130187122 15:81694738-81694760 ATATGATTTCAGAATTACGATGG + Intergenic
1130238837 15:82165731-82165753 AAATGCTTTCAAAATCCAAAAGG - Intronic
1130418976 15:83722923-83722945 AAATACTTCCAAATTTCTGATGG + Intronic
1131487912 15:92837444-92837466 AAGTGCTTTCGGTATTATGAGGG - Intergenic
1133640833 16:7715705-7715727 AAATGCTTTCTGAAAGCAGAGGG - Intergenic
1136465405 16:30439743-30439765 CAATGCCTTCAAAATTCTGAGGG - Intergenic
1137703283 16:50514238-50514260 AAATTCTTCCAAAATACTGAAGG - Intergenic
1137733161 16:50704463-50704485 TAATGCAATCAAAATTCTGAAGG - Intronic
1138383763 16:56622013-56622035 AAAGGCATTCAGAATTATAAGGG + Intergenic
1139726919 16:68907630-68907652 AAATGCTTTGAAAATTCTAAGGG - Intronic
1140077331 16:71713361-71713383 ATATACTTTCATATTTCTGATGG + Intronic
1140337426 16:74121065-74121087 GACTGATTTCAGATTTCTGATGG + Intergenic
1142320643 16:89380571-89380593 AAATGCTTTCACAAGTCCCAAGG - Intronic
1142965236 17:3576923-3576945 AAATGCTTTAAGAATTTTCCAGG - Intronic
1144102026 17:11950007-11950029 AAATGATGTTAGATTTCTGAAGG + Intronic
1145324409 17:21789761-21789783 CAAAGGTTTCAGAACTCTGAAGG - Intergenic
1145725688 17:27121049-27121071 AAAATCTTGCAGTATTCTGAAGG + Intergenic
1146771153 17:35569739-35569761 AGGTGCTTTCATAATTCAGAAGG + Intergenic
1146999202 17:37348520-37348542 CAATGCCTTCAAAATTCTGAAGG + Intronic
1149395342 17:56235851-56235873 AAATGATTTCAAAATTCATATGG - Intronic
1149719648 17:58830230-58830252 TAATGCCTTCAAAATTCTGTGGG - Intronic
1150104599 17:62453078-62453100 AAATGCTTTAGGGATGCTGAAGG - Intergenic
1150409148 17:64928750-64928772 AAATGCTTCCAAAATTATGCCGG - Intergenic
1150680557 17:67280955-67280977 AATTGTATTCAGAATTCTAATGG - Intergenic
1150761263 17:67964445-67964467 AAATGCTTCCAAAATTATGCTGG - Intronic
1151222633 17:72624292-72624314 AAAGCCTTTCTGAATGCTGAGGG - Intergenic
1151245975 17:72794951-72794973 GAATGCCACCAGAATTCTGAGGG + Intronic
1152399146 17:80053850-80053872 CAATGCATACAGAATTCTAAGGG + Intronic
1153120531 18:1719261-1719283 AAATGCTTTTAGAATTGCAATGG - Intergenic
1153132051 18:1865548-1865570 AAAAGCTTTCAGAAATGAGAGGG - Intergenic
1153143234 18:1999327-1999349 AAATACTTTCACAATTATCAGGG + Intergenic
1154069142 18:11137423-11137445 AAATATTTTCACAATTCTCAGGG - Intronic
1154345926 18:13543490-13543512 AAAAGGTTTTAGAATCCTGAAGG + Intronic
1154931332 18:20999986-21000008 AATTGCTATCAAAATTCTAAAGG + Intronic
1155016499 18:21846166-21846188 AAATGATTTTAAAATTCTTATGG - Intronic
1155098848 18:22588576-22588598 AAATGGTTTCAGAACTTAGAAGG + Intergenic
1155568616 18:27164817-27164839 GAATGCCTTCAAAATTCTCAAGG + Intronic
1155843345 18:30673546-30673568 CAATGCATTTAAAATTCTGATGG - Intergenic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156218071 18:35022034-35022056 CCATGCTTTCAAAGTTCTGAGGG + Intronic
1156602589 18:38627056-38627078 AAATGCTTTGAACATTTTGAGGG - Intergenic
1157244823 18:46044092-46044114 AAAGACTTTCAGGATTTTGATGG - Intronic
1157427698 18:47598174-47598196 AAATGGTTTCAGGAGCCTGAGGG + Intergenic
1157607747 18:48936740-48936762 AATTCCTTGCAGAATTATGATGG - Intronic
1157724724 18:49955214-49955236 CACTGCATTAAGAATTCTGAAGG + Intronic
1157767885 18:50315578-50315600 AAATGCTTTCAGAAATTGGCAGG + Intergenic
1157896522 18:51473938-51473960 CAATGCCTTCAAAATTATGAAGG - Intergenic
1157978716 18:52355839-52355861 AAATTCTTCCAGAATGCAGAGGG + Intronic
1157993797 18:52530019-52530041 AATTGCATTCAAAATTTTGAGGG - Intronic
1158032642 18:52985369-52985391 CAATGTCTTCAGAGTTCTGAGGG - Intronic
1158057284 18:53296681-53296703 AAATTCTTTCAAAGTACTGATGG + Intronic
1158076422 18:53535433-53535455 AAATGCTTTCAGAATTATTTAGG - Exonic
1158757108 18:60338703-60338725 AAATGTTTTAAGCATTTTGAGGG + Intergenic
1158828754 18:61254701-61254723 AAATGCTATCAGATATCAGAAGG + Intergenic
1159107428 18:64019078-64019100 AAATGCCTGCAGACATCTGAAGG - Intergenic
1159632492 18:70765017-70765039 AAATGATTTCAGAATTTTGAAGG - Intergenic
1159684546 18:71401931-71401953 AAATTCTTTCAGCAACCTGAAGG + Intergenic
1159828543 18:73244512-73244534 AAGAGTTTTCAGAATTATGAAGG - Intronic
1160276968 18:77445894-77445916 AAGTGTTTTCAGAACTCTGAAGG - Intergenic
1162761686 19:12892212-12892234 AGAGGCTTTCAGAATACAGAGGG - Intronic
1163911763 19:20201541-20201563 ATTTGCTTTCAGCATTCTCAAGG - Intergenic
1164423363 19:28117378-28117400 AAAGGCTAACAAAATTCTGAGGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165123053 19:33574972-33574994 CAATGCTTTTAAAATTCTGAGGG + Intergenic
1166693668 19:44839759-44839781 GAAAGCTTTCAGAATTCTTCAGG - Intergenic
925051465 2:819024-819046 AAATGCTTTAAAAAAACTGAAGG + Intergenic
925354702 2:3230883-3230905 AAATGCCATCAGAACTTTGATGG + Intronic
926456369 2:13072981-13073003 AAATGAGTTAAGAATTCTGTTGG - Intergenic
926790431 2:16565693-16565715 GGATGCTCTCAGAATCCTGAAGG + Exonic
927727468 2:25437633-25437655 AAATGCCTTCAGGACACTGAAGG + Intronic
928871206 2:35982528-35982550 CAATGCTTTCAAAATTCTATGGG + Intergenic
929626481 2:43413888-43413910 CAATCCTTTGAGGATTCTGAGGG - Intronic
929630439 2:43454844-43454866 ATATGCCCTCAGAATTTTGAAGG + Intronic
929630440 2:43454849-43454871 CATTGCCTTCAAAATTCTGAGGG - Intronic
929648418 2:43653382-43653404 AAATGTCTTCAAAATTCTGAAGG + Intronic
929976113 2:46636635-46636657 CAATGCCTTCAACATTCTGAAGG - Intergenic
930227642 2:48810867-48810889 AGATGCCTACAAAATTCTGAGGG - Intergenic
930278619 2:49342689-49342711 AGGTGCTTACAGAATTTTGATGG + Intergenic
930659305 2:54037888-54037910 AAATTCTTTCAGGAATGTGAAGG + Intronic
930954166 2:57184220-57184242 AAAACCTTTCAGAACTCTCATGG + Intergenic
931369917 2:61652727-61652749 AAGAACTTTCAGAATTCTAATGG - Intergenic
931988774 2:67768454-67768476 AAATGCCTTCAAAATTCTGAAGG + Intergenic
931988775 2:67768459-67768481 AATTTCCTTCAGAATTTTGAAGG - Intergenic
933876876 2:86628810-86628832 CAGTGCTTTCAAACTTCTGAGGG - Intronic
934130685 2:88945918-88945940 AGATGCATTCAGTTTTCTGAGGG + Intergenic
934148035 2:89115584-89115606 AAATATTTTCAGGATTGTGAAGG - Intergenic
934221250 2:90085025-90085047 AAATATTTTCAGGATTGTGAAGG + Intergenic
934235023 2:90223129-90223151 AAATCTTTTCAGAATTGTAAAGG + Intergenic
934608568 2:95717229-95717251 AATTGCTTTCAATATTCTGTTGG + Intergenic
934685496 2:96318271-96318293 AAATGCCTTTACAATTTTGAAGG - Intergenic
934889208 2:98051652-98051674 AAAAACTTTCAGAACTCTAATGG + Intergenic
935016019 2:99182718-99182740 AAATATTTACAGACTTCTGAAGG - Intronic
935297715 2:101665234-101665256 CAATGCTTTCAAAATCCTCAGGG - Intergenic
935650265 2:105375872-105375894 AAGTATTTTCAGAAATCTGAGGG + Intronic
935663811 2:105492609-105492631 AAATACCTTCAAAATCCTGAAGG - Intergenic
936393664 2:112100063-112100085 TAATGTTTTCAGAATGCTGTTGG + Intronic
936625701 2:114146393-114146415 ATATGGTTTCAGAATTCACATGG - Intergenic
937130867 2:119511906-119511928 AAATGCCTTCAAAATTTGGAAGG - Intronic
937235121 2:120426719-120426741 TAATGTCTTCAAAATTCTGAAGG - Intergenic
937260497 2:120583340-120583362 AACTGCCTTCAGAACTCTGAGGG - Intergenic
937741942 2:125364943-125364965 AAATGCTTTATTAATTCAGAAGG + Intergenic
937855367 2:126668589-126668611 AAATGCTATCAAACTTCAGAAGG + Intronic
939014787 2:136890040-136890062 CAAGACTTTCAAAATTCTGAAGG - Intronic
939018371 2:136928403-136928425 AAATGCTTTCAAAATGCAGATGG - Intronic
939370559 2:141294244-141294266 AAATGATCACAGAATCCTGATGG + Intronic
940063876 2:149604766-149604788 ATATGCTTTCAAAATTTTTATGG - Intergenic
940164018 2:150748038-150748060 AAATGCTTTCAGAAGTCATAGGG - Intergenic
940181075 2:150933789-150933811 TTTTGCTTTCAGAATTCTGGAGG + Intergenic
940343581 2:152605668-152605690 AAATAATTTCAGAATGCAGAGGG - Intronic
940525116 2:154804032-154804054 AAATGATTTCAGTATTTTGAAGG + Intronic
940622997 2:156137290-156137312 TAATGCTTTCAAAATTATGGAGG + Intergenic
940829799 2:158455272-158455294 AAATATTTTCAGAATTGAGAAGG - Intronic
941598142 2:167504140-167504162 AAATACTCTCAGAATTTAGAAGG + Intergenic
941845182 2:170125493-170125515 TAATGCTTTGAGAATTCTGATGG - Intergenic
942194186 2:173500985-173501007 AAAAACTTTCAGAACTCTCATGG + Intergenic
942683618 2:178507814-178507836 ACATGCCTTCAGAATTTTAAGGG + Exonic
943180290 2:184531257-184531279 AGATGCTGTCACAATTCAGAGGG - Intergenic
943775473 2:191761164-191761186 GAATGCTTTCAGACTTCTGACGG + Intergenic
943907282 2:193515567-193515589 AAATGCTTTCAGTAACCTCAAGG + Intergenic
944206911 2:197166201-197166223 AAAAGCTTTCAGAATCCAGGAGG - Intronic
944260593 2:197671850-197671872 AAATGCTGTAAAAATTCTTAAGG + Intronic
944494565 2:200293723-200293745 AAAGGCTTTCAGAGTTCGGAGGG + Intergenic
944620803 2:201514152-201514174 AAATTCTTCTAGAATACTGAAGG + Intronic
944855986 2:203767344-203767366 ATATTTTTTCAGAATCCTGAGGG - Intergenic
944992152 2:205249988-205250010 AAATGATTTAAATATTCTGAGGG + Intronic
945305989 2:208259227-208259249 AAATGCTTACAGAAATTTCATGG - Intronic
945485144 2:210386601-210386623 AAATGTTTGTAAAATTCTGAAGG + Intergenic
946613865 2:221488270-221488292 AATTACATGCAGAATTCTGAGGG - Intronic
947143410 2:227041344-227041366 AAATGCCTTCAGAAATAAGATGG + Intronic
947148707 2:227092185-227092207 AAATGCCATCAAAATCCTGAGGG + Intronic
947575263 2:231268709-231268731 CAATGTCTTCAAAATTCTGAAGG - Intronic
948494266 2:238336567-238336589 GAATGCTTTCTGGATTCTGCAGG - Intronic
1168770784 20:414991-415013 AAATGCTCTCAAAATTCTTCAGG - Intronic
1170409883 20:16077418-16077440 AAATAGTTTCAGAATTTTGGAGG + Intergenic
1170452857 20:16503464-16503486 AAATGTTTTGAAAATACTGATGG - Intronic
1170542841 20:17406528-17406550 AAGTGGTTGCAGAGTTCTGAGGG + Intronic
1170686345 20:18573129-18573151 TGATGCTTTCAAAATTCTGAGGG - Intronic
1170991617 20:21306461-21306483 AATTTCTTTCAAAGTTCTGAGGG - Intronic
1171157584 20:22890572-22890594 AAACTCTTTAAGAATTCAGATGG - Intergenic
1171309269 20:24133261-24133283 CAATGTCTTCAAAATTCTGAGGG + Intergenic
1172398913 20:34632235-34632257 CAATGCCTTCAAAATTCTAAAGG + Intronic
1173331098 20:42077097-42077119 AAATTCTTCCAGCATTCTAAAGG - Exonic
1174685653 20:52452624-52452646 AAATGCCTTGAGAACCCTGAGGG + Intergenic
1174918067 20:54674033-54674055 AATTGCTTTAAGAAATCTGGTGG + Intergenic
1174999854 20:55615586-55615608 AAATGTTTGCAGACTTCTGTAGG + Intergenic
1177045596 21:16164754-16164776 GCATGCTTTAAGAAGTCTGAAGG - Intergenic
1177209757 21:18056206-18056228 AAATGCCTTCAAAATCTTGAAGG - Intronic
1177302119 21:19261344-19261366 ATTTGCTTTCAAAATTTTGAAGG - Intergenic
1177321864 21:19532854-19532876 AAATACCTACAGAACTCTGAAGG - Intergenic
1177766866 21:25468438-25468460 GAATGCTTTCATTTTTCTGAAGG + Intergenic
1178023612 21:28438501-28438523 TCCTGCTTTCAGGATTCTGAAGG + Intergenic
1178406538 21:32328816-32328838 TCATGTTTTCAGCATTCTGAGGG - Intronic
1178905973 21:36636790-36636812 TAATGCCTTCAAAGTTCTGAAGG - Intergenic
1180610186 22:17091321-17091343 CAATGCTTTCACAATTCTGAGGG - Intronic
1180678302 22:17604389-17604411 AAATATTTTCAGAATCCTCAGGG - Intronic
1182189552 22:28444310-28444332 GAATGCATACAGAAGTCTGAGGG - Intronic
1183113611 22:35672028-35672050 AAAAACTTTCAGAACTCTCATGG + Intergenic
1183842332 22:40509694-40509716 AAATACTTTCAGTAATCTAATGG + Intronic
1184441063 22:44516113-44516135 AAATGCCTTCAGAATTTTGAAGG + Intergenic
1184441064 22:44516118-44516140 GAATGCCTTCAAAATTCTGAAGG - Intergenic
951911240 3:27752863-27752885 CAATGCTTTCAACATTGTGAAGG + Intergenic
952130414 3:30355337-30355359 AAATGCTTTCAGTGTTTTAAAGG - Intergenic
952529146 3:34245241-34245263 CAATGCCTTCAAAATTCAGAGGG - Intergenic
952734153 3:36671875-36671897 AAATTTTTTCTGAATTCTGCAGG - Intergenic
952765344 3:36948336-36948358 TAATAGCTTCAGAATTCTGAAGG - Intergenic
953163124 3:40440670-40440692 TAATGCCTTCAAAATTCTGAGGG + Intergenic
953554267 3:43930743-43930765 AAATACTTTCCAAATGCTGATGG + Intergenic
955042346 3:55330018-55330040 AAATGCTTTCAGGGTTCTTCAGG + Intergenic
955492688 3:59499028-59499050 AATTGCATTTTGAATTCTGATGG + Intergenic
955753614 3:62206311-62206333 AGATGCTCTCAGATTTCTGTAGG - Intronic
955976347 3:64484167-64484189 AAAGGCTTTGATAATTCTGATGG + Intergenic
955985259 3:64567142-64567164 AAATACATTCAGGTTTCTGAAGG + Intronic
956491681 3:69779119-69779141 TAATGTTTGCAGAATTCTGTTGG + Intronic
956951360 3:74287197-74287219 AAATGGTTTTATGATTCTGAAGG - Intronic
957094905 3:75769175-75769197 AAATGCTCTGGGACTTCTGAGGG + Intronic
957325539 3:78688452-78688474 AAATGCTTTCAGAATTCAAGCGG + Intronic
957666513 3:83237195-83237217 AAGTGTTTTCAAAAATCTGAAGG + Intergenic
958477794 3:94606978-94607000 ATCTGCCTTCAGAATTTTGAAGG + Intergenic
958628636 3:96658860-96658882 AAAGGCTTTGAGAATTCCTATGG - Intergenic
958912972 3:100015577-100015599 CATTGCTTCTAGAATTCTGATGG + Intronic
959392847 3:105797689-105797711 AAATGCTTTTGAATTTCTGATGG + Intronic
959394266 3:105817054-105817076 ACATGTTTTTAGAATTATGAAGG + Intronic
960145273 3:114194258-114194280 AAATGGATTCAGGATTCAGAGGG - Intronic
960723527 3:120647891-120647913 AGATGCTTTTACAATTCAGATGG - Exonic
960768170 3:121161442-121161464 AATTGCTTTCAAAATTTTGCGGG + Intronic
961142825 3:124569660-124569682 AAAGGCTTTCAGACTTGGGAGGG - Intronic
961495175 3:127286290-127286312 AAATGCCTTCAAAATTTCGAGGG + Intergenic
961730147 3:128959329-128959351 CAATGCCTTCAAAACTCTGAAGG + Intronic
962589561 3:136874864-136874886 ATTTGCCTTCAGAATTCTGAAGG + Intronic
962589562 3:136874869-136874891 CAAGGCCTTCAGAATTCTGAAGG - Intronic
962846186 3:139275709-139275731 AGATGCTTTTGGAACTCTGAGGG + Intronic
963182505 3:142373681-142373703 CAGTGGTTTCAAAATTCTGAGGG + Intronic
963182884 3:142378963-142378985 CAGTGGTTTCAAAATTCTGAGGG + Intronic
963677927 3:148336669-148336691 ATATGCTCTCAGAATTCTTCTGG + Intergenic
964123832 3:153215454-153215476 AAATGCTTTAATAGTTCTGAGGG - Intergenic
964158986 3:153623288-153623310 CAATGCCATCACAATTCTGAGGG + Intergenic
964727320 3:159827001-159827023 AAATTATTTCAGAATTATAAAGG - Intronic
964898813 3:161632018-161632040 AAATAATTTCAAAATTATGATGG - Intergenic
965480078 3:169207513-169207535 ATTTGCTTTCAGAATCCTGGTGG + Intronic
965502217 3:169470701-169470723 AAATACTTTCAGAATCCTAATGG + Intronic
965730126 3:171762760-171762782 AATTGTTTTCAGATATCTGAAGG + Intronic
965841593 3:172911595-172911617 AAATGCCTTTAGAATTCAGTTGG - Intronic
965851180 3:173027484-173027506 AGAAGCTTAGAGAATTCTGAGGG - Intronic
966489428 3:180510721-180510743 AAATGCCTTCAAAATTCTGAAGG + Intergenic
966812592 3:183860753-183860775 AAATGCTTTGAAAATAGTGAAGG + Intronic
967115213 3:186331488-186331510 AAATCCTCTCTGAATTCTTATGG - Intronic
968348444 3:198031592-198031614 AAATGCTTTCAGAATTCTGATGG - Intronic
969215133 4:5715708-5715730 AAATGCCTTCGAAATTCTGGAGG - Intronic
969582922 4:8076317-8076339 AAAAGCATTCAGAATGCGGAGGG - Intronic
969953128 4:10860615-10860637 AATAGCTTCCAGAATTCTGATGG - Intergenic
970160162 4:13180194-13180216 ACCTGCTTTCAGAACTGTGAGGG - Intergenic
970353424 4:15228850-15228872 AAAGACTTTCAGAATTTTAATGG - Intergenic
970415165 4:15849752-15849774 AAATGCTTTCTGATTTCTTTGGG + Exonic
970760940 4:19485653-19485675 GTATTCTTTCAAAATTCTGAAGG + Intergenic
970802949 4:19996512-19996534 GAATGCCTTCAAAATTCTAAGGG + Intergenic
971517438 4:27505764-27505786 ACATTTTTTCTGAATTCTGAGGG - Intergenic
971607895 4:28682350-28682372 AAAAGGTTTTAAAATTCTGAGGG + Intergenic
971913317 4:32825065-32825087 AAAAACTTTCAGAACTCTCAAGG - Intergenic
972172873 4:36368192-36368214 AAATAATTTCTGAATTTTGAAGG + Intergenic
972853476 4:43077612-43077634 AAAAACTTTCAGAACTCTCATGG - Intergenic
973655116 4:53039109-53039131 AGAGCTTTTCAGAATTCTGAAGG - Intronic
973961047 4:56110216-56110238 CAGTGCCTTCAAAATTCTGAGGG + Intergenic
974099371 4:57399956-57399978 AATTGTTTTCAGAGTTCTAAAGG + Intergenic
975046837 4:69815674-69815696 AAATGCTATCACAATTCTTCAGG - Intronic
976173593 4:82330101-82330123 GAATGCTTTCAAAGTTCTGAGGG + Intergenic
976786498 4:88827190-88827212 AAAGACTTTCAGAAAACTGAAGG - Intronic
977153166 4:93539727-93539749 CAATGCATTCAAACTTCTGAAGG - Intronic
977285454 4:95100357-95100379 CAATGCCTTCAAAAGTCTGAGGG - Intronic
978195595 4:105968068-105968090 AAATGCATTCATAATTTTGTTGG - Intronic
978258749 4:106724765-106724787 AATTCCTTTCACATTTCTGAAGG - Intergenic
978342411 4:107732743-107732765 AAATACTTTCAGAGCTCTGAAGG - Intergenic
979024851 4:115556822-115556844 AAATGCTTTGGGAATTCCCAGGG - Intergenic
979116157 4:116826946-116826968 AAATGCTTCCAGAATAATGCAGG + Intergenic
979690264 4:123551954-123551976 GAATGCCTTCAAAAATCTGAAGG - Intergenic
980419701 4:132543895-132543917 AAAAACTTTCAGAACTCTCATGG + Intergenic
980745759 4:137012750-137012772 CAAAGCTTTCAAAATCCTGAGGG - Intergenic
980843814 4:138300040-138300062 ACATGCTGTGTGAATTCTGATGG + Intergenic
981678242 4:147364307-147364329 TAATGCCTTCAAAATTCTGAAGG + Intergenic
981914745 4:150021742-150021764 GAATGCTTTCATTTTTCTGATGG + Intergenic
982236756 4:153258252-153258274 AATGGCATTCAGAATTCGGAGGG - Intronic
982357642 4:154488362-154488384 TGATGCTTTCAGGACTCTGAGGG - Intronic
982850333 4:160307166-160307188 CAATGCTTTGAGCATGCTGAGGG + Intergenic
982915309 4:161201857-161201879 ATATGCTTTCATATTTCTAAAGG - Intergenic
982958119 4:161797215-161797237 AGATGTTTTGAGATTTCTGAGGG + Intronic
984155191 4:176187703-176187725 AAATGCTTTCTGAATTAACAGGG + Intronic
984189053 4:176582852-176582874 AAATGCTTTTTGACTTATGACGG - Intergenic
984191387 4:176610106-176610128 AAATACCTTCAAAATTCTGAGGG - Intergenic
984672077 4:182502086-182502108 ATTTGCTCTCAGAATTGTGAAGG + Intronic
985781185 5:1872640-1872662 AAATGCTTCCAGAATCCTGCAGG + Intergenic
986014076 5:3742087-3742109 AATGGCATTCAGAATTTTGAGGG + Intergenic
986056712 5:4144498-4144520 ACATGCATGCGGAATTCTGACGG + Intergenic
986354959 5:6914729-6914751 AAATGCTGTTAAAATTGTGAAGG + Intergenic
986457914 5:7938906-7938928 AAAGGTTGTCAGAATGCTGAAGG + Intergenic
987073155 5:14357308-14357330 AAATGCTTTCAGCCTCCTCAGGG - Intronic
987330795 5:16855866-16855888 AAATGCTCACTGAATTCTCAAGG + Intronic
987371565 5:17198236-17198258 AAAGACTTTCAAAATTCTAAAGG - Intronic
987464152 5:18252502-18252524 AAAGGCATTCAGATTTATGAGGG + Intergenic
988780191 5:34513579-34513601 AAATGCTGGCACAATTCAGATGG - Intergenic
989308623 5:39986917-39986939 AAATGCCTTCAGATTTTTAATGG + Intergenic
989381789 5:40816564-40816586 CAATACCTTCAAAATTCTGAAGG - Intergenic
989738693 5:44741482-44741504 AAATTATTTCAGAATTATGGGGG + Intergenic
990020086 5:51115906-51115928 AAATGTTCTTAGAATCCTGAAGG + Intergenic
990189929 5:53248657-53248679 AAATGGTTTCAGATTTAAGATGG - Intergenic
990379766 5:55211542-55211564 AAATGGTTTCAGAATTATTTTGG + Intergenic
992829402 5:80579710-80579732 CAATGCCTTCAGATTTTTGAAGG + Intergenic
993504914 5:88696710-88696732 AATTGCTTTCAGAGGTTTGATGG - Intergenic
993713817 5:91254545-91254567 AAATACTTTCATATCTCTGATGG - Intergenic
993739704 5:91523061-91523083 GAATGCTTTTAAGATTCTGAGGG - Intergenic
994072308 5:95616877-95616899 TAATGCCTTCAAAATTCAGAAGG + Intergenic
994328357 5:98476214-98476236 AAATGACTTCAGATTTCTGATGG + Intergenic
994374150 5:98999360-98999382 AAATGCTTTTAGAAATATGTAGG - Intergenic
994379167 5:99050292-99050314 AACTGGATTCAGAATTCTGAAGG - Intergenic
994665571 5:102700571-102700593 AAATATATTTAGAATTCTGAGGG + Intergenic
994748455 5:103708400-103708422 ACATGCTTTGAGAATGTTGATGG + Intergenic
995243662 5:109913439-109913461 AAATGCTATGAGAATTCAAAAGG - Intergenic
995286496 5:110394922-110394944 CAAAGCTTTCAGAATGGTGAGGG + Intronic
995441561 5:112197961-112197983 ATAATCTTTCAGACTTCTGAAGG + Intronic
995578561 5:113569838-113569860 AAACGATTTCAAAATTCTTATGG - Intronic
995637694 5:114213600-114213622 AAATGCTTTCAATAGTTTGAAGG - Intergenic
995666821 5:114552100-114552122 AAACTCTTTTAAAATTCTGATGG + Intergenic
995862701 5:116659061-116659083 CACTGCTTTCAGTATTCTCATGG + Intergenic
995959479 5:117822237-117822259 AAACTCTTTCAAAATTCTGATGG - Intergenic
996094414 5:119383015-119383037 AAATGCTTTAATAATACTAAAGG - Intronic
996155732 5:120097114-120097136 AAATGGTTTGTGAATTCTGATGG + Intergenic
996808766 5:127489538-127489560 AAATGCTTTTAAGATTCTAAGGG + Intergenic
996871918 5:128201555-128201577 ACATGCTTTGAGAAGTCAGAAGG + Intergenic
996972798 5:129393386-129393408 AAATGCTTTAAGAATTTTATAGG - Intergenic
997361162 5:133295937-133295959 AAATGCTGTCAGTATGCTAAGGG + Intronic
997435619 5:133872545-133872567 CAATGCCTTCAAATTTCTGAGGG + Intergenic
997750319 5:136338094-136338116 AAATGCTTTGAAAATTCAGAAGG - Intronic
997817294 5:137031539-137031561 ATGTGCTTTCATAATTCTGGGGG - Intronic
998065544 5:139155308-139155330 AAATTTTCTCACAATTCTGAAGG + Intronic
999981794 5:156965017-156965039 GAATGCCTTCAAAATTCAGAGGG + Intergenic
1000061211 5:157657501-157657523 AAACACTTTCAGAATACTCATGG + Intronic
1000705134 5:164501810-164501832 AAATGCATTCATACTTTTGAAGG - Intergenic
1000844063 5:166257121-166257143 ATTTGCTTTCAAAATTCTGGTGG - Intergenic
1001832238 5:174798610-174798632 AAATGATTTCAGCTGTCTGACGG + Intergenic
1002077213 5:176715452-176715474 TAATGCTTTAAAAATTCTGAAGG - Intergenic
1002433171 5:179215875-179215897 GAAAGCCTTCAGAATTCTGAAGG + Intronic
1002433172 5:179215880-179215902 ATTTTCCTTCAGAATTCTGAAGG - Intronic
1002514679 5:179748853-179748875 CAATGTCTTCAAAATTCTGAAGG + Intronic
1003369471 6:5510422-5510444 AAATGCTCTCTGAGGTCTGAAGG - Intronic
1004509309 6:16271873-16271895 AAATGCTTTCAGTATAATGTTGG - Intronic
1004605706 6:17193244-17193266 TAATACTTTCAGCATTCTGCTGG - Intergenic
1004941751 6:20565931-20565953 TAATGCTTTCAGATTTTTGTGGG + Intronic
1005273658 6:24193088-24193110 AATTTCTCTCAGAATTGTGAGGG - Intronic
1005321264 6:24656700-24656722 GAATGCCTTCAGAATTCTGAAGG + Intronic
1005374620 6:25169745-25169767 TGATGTTTACAGAATTCTGAGGG + Intergenic
1005966958 6:30733398-30733420 GAATGCCTTCAGAATTCTGATGG - Intronic
1006088737 6:31615525-31615547 AAAAGCTTTCGGACTGCTGAAGG + Exonic
1006275596 6:33002858-33002880 AAATGCCTTAAAAATTCTGATGG + Intergenic
1007045555 6:38770465-38770487 AACTGATTTCAGAATCCTCAGGG + Exonic
1007457009 6:41986314-41986336 AAATGTCATCAGAATTTTGATGG + Intronic
1007531988 6:42551243-42551265 AAATGCCTTCAAAATTCTGGAGG + Intergenic
1007803774 6:44421177-44421199 AAATGCATTAAAAATTATGATGG - Intronic
1008084806 6:47233302-47233324 AAATTATTTTAGAATTCAGAAGG + Intronic
1008445893 6:51590242-51590264 AAATGCCATTAGAATTTTGATGG + Intergenic
1009283490 6:61781521-61781543 AAAAGCTTGCAGATTTCTAATGG - Intronic
1009338465 6:62524325-62524347 AAATGATTTCAAAATCCTAAAGG - Intergenic
1009370265 6:62891599-62891621 ATATACTTTCAGTATTGTGAAGG + Intergenic
1009501049 6:64414293-64414315 CCATGCCTTCAAAATTCTGAGGG + Intronic
1010080214 6:71852945-71852967 ATATGCTTTTATAGTTCTGAAGG - Intergenic
1010371516 6:75115096-75115118 AAATGCTCTGAGAAAGCTGATGG - Intronic
1010560908 6:77348989-77349011 AAATGTTTTCAGAATTATTAAGG + Intergenic
1011067910 6:83348589-83348611 ATTTGGTTTCAAAATTCTGAAGG + Intronic
1011891692 6:92170992-92171014 AACAGTTTTCAGAATTCTGTTGG + Intergenic
1012121580 6:95374198-95374220 AAACACTTACAGACTTCTGATGG + Intergenic
1012378752 6:98593907-98593929 AATTTCATTCTGAATTCTGAAGG - Intergenic
1012577692 6:100823111-100823133 AGCTGATCTCAGAATTCTGATGG - Intronic
1012578851 6:100838459-100838481 AAATGCTGTCATAATTTTCATGG - Intronic
1013034638 6:106369070-106369092 AAATGTGTTCAGAATACTGATGG + Intergenic
1013034822 6:106371208-106371230 AAATGTTTTCATAATACTGATGG + Intergenic
1014044303 6:116866721-116866743 AAATGCTTTCAGAATTGCCTGGG - Intergenic
1014512128 6:122336200-122336222 AAATTATTTCAGAATACTGAGGG + Intergenic
1014741072 6:125147988-125148010 AATTGCATTGAGAACTCTGATGG - Intronic
1014971796 6:127825410-127825432 TAAAGTTTTCAAAATTCTGAGGG + Intronic
1014972960 6:127841407-127841429 AAAAGCTTTTAGAATTGTGCCGG + Intronic
1015570230 6:134613300-134613322 AAATCTTTCCAGAATACTGATGG + Intergenic
1015650730 6:135456220-135456242 AAACTCTTACAAAATTCTGAAGG - Intronic
1015867918 6:137746294-137746316 AAATGTTTTTAGAAGTCAGAAGG + Intergenic
1016299532 6:142614743-142614765 AAATCCTCTCAAAATTCTGGAGG + Intergenic
1016493389 6:144632063-144632085 GAAAGCTTTCTGAATTCTGTGGG + Intronic
1016828349 6:148408659-148408681 AAACGTTTTCATAATTCTGATGG + Intronic
1018078323 6:160236224-160236246 AAATACTTTCAGGACTCTCAGGG + Intronic
1019053725 6:169205000-169205022 AATTGCTTTCAAAATTCTGATGG - Intergenic
1019642335 7:2110698-2110720 AGATGCTTTCAGATCTGTGACGG + Intronic
1019843760 7:3475924-3475946 AAATGCTAACAGAATTTTAAAGG - Intronic
1020242582 7:6407271-6407293 TAGTCCCTTCAGAATTCTGAGGG + Intergenic
1020242584 7:6407276-6407298 AACTGCCCTCAGAATTCTGAAGG - Intergenic
1020866975 7:13577605-13577627 AAATGTTTTCAGAATTCCCAGGG + Intergenic
1020898563 7:13973784-13973806 AAATATTTTCAGAATTGTGAAGG - Intronic
1021010330 7:15455702-15455724 CAATGCCTTCAAAATTCTGAAGG - Intronic
1021225952 7:18026526-18026548 CAAAGATTTCAGACTTCTGAGGG - Intergenic
1022182952 7:27939802-27939824 AAACCCCTTCAGAATTCAGATGG + Intronic
1022539580 7:31123459-31123481 AATTGCTGGCAGATTTCTGAGGG + Intergenic
1022585739 7:31607470-31607492 TATTTCCTTCAGAATTCTGAAGG + Intronic
1022585740 7:31607475-31607497 CAAGGCCTTCAGAATTCTGAAGG - Intronic
1023291328 7:38671765-38671787 AAATGCTTTCAGAAATAAAAAGG + Intergenic
1023630743 7:42161836-42161858 AAATGTAGTCAGGATTCTGAGGG + Intronic
1024052815 7:45639720-45639742 AGATGCATTCAGATTTCAGATGG + Intronic
1024776775 7:52797073-52797095 CAATGCTTTTAAAATTCTGAGGG - Intergenic
1025634620 7:63311425-63311447 AAAAACTTTCAGAACTCTCATGG + Intergenic
1025648076 7:63436745-63436767 AAAAACTTTCAGAACTCTCATGG - Intergenic
1026403722 7:70042917-70042939 ATATGATTTCAGCATTCTCACGG + Intronic
1028232835 7:88326049-88326071 AAGTGCTTTAAGAATTCTAGGGG - Intergenic
1028551485 7:92072493-92072515 AAATGCTTTCAGATATCTGATGG + Intronic
1028679910 7:93514897-93514919 AAATACTTTTAGAAATCTAATGG + Intronic
1029077614 7:97948489-97948511 AAATGATGTCAGAAAACTGAAGG - Intergenic
1029968042 7:104761076-104761098 AAATGCTCCCATATTTCTGATGG - Intronic
1030055260 7:105578722-105578744 CAATGCCTTAAAAATTCTGAGGG + Intronic
1030062378 7:105633085-105633107 AAATGTCTTCAAAATTCTGTAGG + Intronic
1030155734 7:106452735-106452757 AAAAACTTTCAGGATTCTCATGG - Intergenic
1030859337 7:114605014-114605036 AAATGTTTTCACATTTCTAATGG - Intronic
1031265863 7:119579111-119579133 AACAGCTTTCTGATTTCTGAAGG - Intergenic
1031371494 7:120972971-120972993 AAGTTCTTCCAGACTTCTGAAGG + Intronic
1031902099 7:127422332-127422354 AAATGCCTTTGGAATTTTGATGG - Intronic
1032099455 7:128961676-128961698 AAAAGCTTTCAGAAATATGGTGG - Intronic
1032233981 7:130103642-130103664 AAATGCCTTCAGTGTTCTGAGGG + Intronic
1033221854 7:139532167-139532189 TAATACCTTCAAAATTCTGAAGG + Intronic
1033453184 7:141479569-141479591 AAATGCTTTGAGAATACCCAGGG - Exonic
1033859668 7:145608957-145608979 AAGTATTTCCAGAATTCTGAAGG + Intergenic
1034486422 7:151367072-151367094 AAATGCTTTAAAAATTGTTACGG + Exonic
1035138885 7:156737248-156737270 CAATGCCTTCAGAATTCTGAAGG - Intronic
1036448575 8:8845059-8845081 ATGTGCATTCAGAATACTGAGGG - Intronic
1037270518 8:17124784-17124806 CAATGCTTTCAGAATTCTGAGGG - Intergenic
1037924818 8:22835819-22835841 AAATGCTTTCAAATATCTGAGGG - Intronic
1039038801 8:33387167-33387189 GAATGCTTCCTGATTTCTGATGG - Intronic
1040797481 8:51301733-51301755 AAGTTCTTTGAGAAATCTGAGGG + Intergenic
1042172630 8:66007366-66007388 ACATGTTTTCAGAAATCTGTTGG - Intergenic
1042635489 8:70868832-70868854 AAAGGCATTCAGAATTATAAGGG - Intergenic
1042649809 8:71027132-71027154 AAATGCTTACAGATTTCTTAGGG - Intergenic
1043092143 8:75918227-75918249 AAAGGCTTTCAGCATTCAGTAGG + Intergenic
1043575887 8:81655842-81655864 CAATGCTTTAAAAATTCCGAGGG + Intergenic
1043968754 8:86507816-86507838 AAAATCTTTCAGAATTATTATGG - Intronic
1044061038 8:87636032-87636054 AAATGCTTTCTAGATCCTGAGGG - Intergenic
1044195310 8:89369518-89369540 CATTTCTTTCAAAATTCTGAAGG + Intergenic
1044270636 8:90239138-90239160 GAATGCCTCCAGAATTTTGAAGG - Intergenic
1045139475 8:99264523-99264545 TGATGCTTTCAGATTTCTGTAGG - Intronic
1045194164 8:99913122-99913144 AAATGCCTTCCAACTTCTGAGGG - Intergenic
1045324272 8:101105978-101106000 CAATGCTTTCAGGATTCAGAAGG + Intergenic
1045618455 8:103946006-103946028 AAAGGCATTCAGAATGGTGAGGG + Intronic
1045709881 8:104970783-104970805 AAATACCTTCAAAATTCCGAGGG + Intronic
1045818838 8:106310707-106310729 AAATGCTTTCAAAATTTAGGAGG - Intronic
1045972394 8:108093616-108093638 AAATGCCTTCAAAATACTAAAGG - Intergenic
1046046698 8:108973257-108973279 AAAGTGTTTCAGAATTCTGGAGG - Intergenic
1046279574 8:112008282-112008304 CAATGCTTTGAGAATTCAAATGG - Intergenic
1046531422 8:115450926-115450948 ATATGTCATCAGAATTCTGATGG - Intronic
1046803473 8:118454248-118454270 CAATGCCTTCAAAATTGTGAGGG - Intronic
1047266227 8:123311965-123311987 AAATTCTTTCACAGTTCTGGAGG + Intergenic
1048692160 8:136978487-136978509 AATTGCTCTCAGAATTCTGGAGG + Intergenic
1048774261 8:137928056-137928078 AAATGCCTTAAGAATTTTCAAGG - Intergenic
1048802582 8:138207554-138207576 AGATGCCTTCAGCTTTCTGAAGG + Intronic
1048994005 8:139778181-139778203 TAATGCCTTATGAATTCTGATGG - Intronic
1050081215 9:1917784-1917806 AATTGCTTTCTGAATTCTCCAGG + Intergenic
1050131363 9:2415893-2415915 CAATGCCTTCAGAATTTTGAGGG - Intergenic
1050921709 9:11211781-11211803 GAATGCTCTCATAATTCTTATGG - Intergenic
1050982983 9:12043565-12043587 GAAAGCTTTCAGATTTCTCATGG - Intergenic
1052299866 9:26942045-26942067 ATTTTCTTTCAGAATTGTGATGG - Intronic
1053379132 9:37635041-37635063 CAATGTCTTCAAAATTCTGAGGG - Intronic
1054351704 9:64022467-64022489 AAATGCTTTTGGGATTTTGATGG + Intergenic
1054841905 9:69751190-69751212 AAAGTCTTTCAAAATTTTGAAGG + Intronic
1055025213 9:71712225-71712247 AGAGGCTTTCAGATTTATGATGG - Exonic
1055379113 9:75686920-75686942 AAGTGCTTTCACAATCCAGAAGG + Intergenic
1055412024 9:76040992-76041014 AAATGCTTTTGGAAAACTGATGG - Intronic
1055457473 9:76486455-76486477 CAATGCTTTCCAAATTCTGAAGG - Intronic
1055644605 9:78350847-78350869 AAATGGATTGAGAATTCTTAGGG - Intergenic
1055992536 9:82122930-82122952 CAATGCTTACAAAATTCTAATGG - Intergenic
1056543094 9:87591243-87591265 ACATGCTTTCAGAAGCCTAAGGG - Intronic
1056911988 9:90709449-90709471 GAATGCTTTCAAAAGTCTGAGGG + Intergenic
1057924588 9:99133168-99133190 AAATGTATTCAGAATTGTGAAGG + Intronic
1058355541 9:104079611-104079633 AAAAACTTTCAGAACTCTCATGG - Intergenic
1058396746 9:104562454-104562476 TAATGCTTTCAAATATCTGATGG - Intergenic
1059206159 9:112468089-112468111 CAATGGCTTCAAAATTCTGAGGG - Intronic
1059222933 9:112642785-112642807 AACTGCTTTCAAAATTTTGGAGG - Intronic
1059583492 9:115578613-115578635 AAATGCTTTTATAATTTTGGGGG - Intergenic
1059666553 9:116451760-116451782 AAAGGCTTTCAGAATGGAGAGGG - Intronic
1059785979 9:117584766-117584788 AGATGCTTCCAGACTTCTTAAGG - Intergenic
1059856231 9:118400594-118400616 AAATGTTCTCAGAGTTCTGGAGG - Intergenic
1061707145 9:132461880-132461902 AAATGCTTACTGCATTCTCAAGG - Intronic
1203496018 Un_GL000224v1:152224-152246 AAATTCATTCAGAATACAGAAGG + Intergenic
1203508641 Un_KI270741v1:94147-94169 AAATTCATTCAGAATACAGAAGG + Intergenic
1185830573 X:3298674-3298696 AAATGTTGACTGAATTCTGAGGG + Intergenic
1186540635 X:10396492-10396514 TAATGCCTTCAAATTTCTGAAGG - Intergenic
1187166176 X:16806213-16806235 AAACGCTTCCAGTATTTTGAGGG - Intronic
1187599439 X:20811470-20811492 AAATGTTTTTAAAAATCTGATGG - Intergenic
1187817227 X:23245732-23245754 AAAAGCTTTCAGGACTCTCATGG + Intergenic
1189078879 X:37947616-37947638 AAATGATATCAGTTTTCTGATGG - Intronic
1189174165 X:38937573-38937595 AAATACTTTCAGAGTACTCAAGG + Intergenic
1189344505 X:40230559-40230581 AAATGCCTTCACAATTCTAAGGG - Intergenic
1189831065 X:44973543-44973565 CAATGTTTTCAAAATTCTGAAGG - Intronic
1189846056 X:45139539-45139561 CAATGACTTCAAAATTCTGAAGG - Intergenic
1190877279 X:54468936-54468958 AACTGTTTTAAGAATTCTGGGGG - Intronic
1192484126 X:71510485-71510507 AAAAGCTTTTCAAATTCTGAGGG + Intronic
1193140022 X:78017614-78017636 GAATGCTTTCAGAATAATGTAGG + Intronic
1193732122 X:85114412-85114434 AAACGCTTTCAGAACTCTCATGG - Intergenic
1193782034 X:85714853-85714875 AAATGCTTTTAGAATACTAATGG + Intergenic
1193855913 X:86601308-86601330 AGAAACTTTCAGAATTCTGTAGG + Intronic
1194498931 X:94656189-94656211 AAATGTTTTCTGATTTCTGTTGG + Intergenic
1194833226 X:98651024-98651046 AGATTCTTTCAGAACTGTGAGGG - Intergenic
1194839188 X:98717656-98717678 AAATGCTTAGAGAGTTCTAAAGG + Intergenic
1194923766 X:99798311-99798333 CAATGCCTTCAAAATTTTGAGGG - Intergenic
1194989490 X:100531053-100531075 AATTCCTATCAGAATTCTCATGG - Intergenic
1195744139 X:108097329-108097351 AAATGCTGTCAGAGTTCTTTGGG + Intronic
1196035355 X:111137917-111137939 AAATGCTCACAGAATTTTGCAGG + Intronic
1196461688 X:115938588-115938610 AAATACTTTCTGAATTCTGGAGG - Intergenic
1196486921 X:116222733-116222755 AAATGAATTCAGAATTCTACTGG - Intergenic
1196666157 X:118318944-118318966 TAAAGCCTTCAAAATTCTGAAGG + Intergenic
1197041477 X:121941025-121941047 AAATGATTTCTGAATGTTGATGG + Intergenic
1197735246 X:129845552-129845574 AAATCCTTTAAGAATTTTGAAGG - Intergenic
1197912560 X:131500011-131500033 AAATCATTTTAGAATTCTGATGG - Intergenic
1198212248 X:134527253-134527275 CAATGCCTTCAATATTCTGAAGG - Intergenic
1201669397 Y:16500368-16500390 AGATGCTTTAAGAATTACGAAGG + Intergenic
1201987033 Y:19979895-19979917 AAATGTTTACAGAAGGCTGAGGG + Intergenic