ID: 968357454

View in Genome Browser
Species Human (GRCh38)
Location 3:198120292-198120314
Sequence GGTGAGCTCAGCCACAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968357454_968357457 8 Left 968357454 3:198120292-198120314 CCTTGACTGTGGCTGAGCTCACC No data
Right 968357457 3:198120323-198120345 GTTTGATGCTAAGAACATGATGG No data
968357454_968357458 30 Left 968357454 3:198120292-198120314 CCTTGACTGTGGCTGAGCTCACC No data
Right 968357458 3:198120345-198120367 GCTGCCTGTGACCCCCGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968357454 Original CRISPR GGTGAGCTCAGCCACAGTCA AGG (reversed) Intergenic
No off target data available for this crispr