ID: 968357458

View in Genome Browser
Species Human (GRCh38)
Location 3:198120345-198120367
Sequence GCTGCCTGTGACCCCCGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968357456_968357458 8 Left 968357456 3:198120314-198120336 CCAGCAGATGTTTGATGCTAAGA No data
Right 968357458 3:198120345-198120367 GCTGCCTGTGACCCCCGTCACGG No data
968357454_968357458 30 Left 968357454 3:198120292-198120314 CCTTGACTGTGGCTGAGCTCACC No data
Right 968357458 3:198120345-198120367 GCTGCCTGTGACCCCCGTCACGG No data
968357455_968357458 9 Left 968357455 3:198120313-198120335 CCCAGCAGATGTTTGATGCTAAG No data
Right 968357458 3:198120345-198120367 GCTGCCTGTGACCCCCGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968357458 Original CRISPR GCTGCCTGTGACCCCCGTCA CGG Intergenic
No off target data available for this crispr