ID: 968359808

View in Genome Browser
Species Human (GRCh38)
Location 3:198138956-198138978
Sequence AGCCCCAACATGGAAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968359802_968359808 -8 Left 968359802 3:198138941-198138963 CCCCTGTCTCCGAGAAGCCCCAA No data
Right 968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG No data
968359800_968359808 15 Left 968359800 3:198138918-198138940 CCAGTCACTGAGGCTGTGATCCT No data
Right 968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG No data
968359801_968359808 -5 Left 968359801 3:198138938-198138960 CCTCCCCTGTCTCCGAGAAGCCC No data
Right 968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG No data
968359803_968359808 -9 Left 968359803 3:198138942-198138964 CCCTGTCTCCGAGAAGCCCCAAC No data
Right 968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG No data
968359799_968359808 22 Left 968359799 3:198138911-198138933 CCAATGGCCAGTCACTGAGGCTG No data
Right 968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG No data
968359804_968359808 -10 Left 968359804 3:198138943-198138965 CCTGTCTCCGAGAAGCCCCAACA No data
Right 968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968359808 Original CRISPR AGCCCCAACATGGAAGGCTC AGG Intergenic
No off target data available for this crispr