ID: 968359851

View in Genome Browser
Species Human (GRCh38)
Location 3:198139214-198139236
Sequence CTGCCGGCCTTCAGTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968359851_968359853 -8 Left 968359851 3:198139214-198139236 CCATCAGCACTGAAGGCCGGCAG No data
Right 968359853 3:198139229-198139251 GCCGGCAGCAGAGAGATAAAGGG No data
968359851_968359852 -9 Left 968359851 3:198139214-198139236 CCATCAGCACTGAAGGCCGGCAG No data
Right 968359852 3:198139228-198139250 GGCCGGCAGCAGAGAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968359851 Original CRISPR CTGCCGGCCTTCAGTGCTGA TGG (reversed) Intergenic
No off target data available for this crispr