ID: 968360496

View in Genome Browser
Species Human (GRCh38)
Location 3:198143683-198143705
Sequence GCCTCAAGAGATCAGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360496_968360509 24 Left 968360496 3:198143683-198143705 CCTGGCTGCTGATCTCTTGAGGC No data
Right 968360509 3:198143730-198143752 TTGGCCACCCACACCTCCCCTGG No data
968360496_968360510 25 Left 968360496 3:198143683-198143705 CCTGGCTGCTGATCTCTTGAGGC No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data
968360496_968360500 0 Left 968360496 3:198143683-198143705 CCTGGCTGCTGATCTCTTGAGGC No data
Right 968360500 3:198143706-198143728 CACGTGAGGGCCCCCCTCCCTGG No data
968360496_968360501 5 Left 968360496 3:198143683-198143705 CCTGGCTGCTGATCTCTTGAGGC No data
Right 968360501 3:198143711-198143733 GAGGGCCCCCCTCCCTGGCTTGG No data
968360496_968360512 29 Left 968360496 3:198143683-198143705 CCTGGCTGCTGATCTCTTGAGGC No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360496 Original CRISPR GCCTCAAGAGATCAGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr