ID: 968360502

View in Genome Browser
Species Human (GRCh38)
Location 3:198143716-198143738
Sequence GGTGGCCAAGCCAGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360502_968360510 -8 Left 968360502 3:198143716-198143738 CCCCCCTCCCTGGCTTGGCCACC No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data
968360502_968360519 11 Left 968360502 3:198143716-198143738 CCCCCCTCCCTGGCTTGGCCACC No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360502_968360512 -4 Left 968360502 3:198143716-198143738 CCCCCCTCCCTGGCTTGGCCACC No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360502_968360509 -9 Left 968360502 3:198143716-198143738 CCCCCCTCCCTGGCTTGGCCACC No data
Right 968360509 3:198143730-198143752 TTGGCCACCCACACCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360502 Original CRISPR GGTGGCCAAGCCAGGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr