ID: 968360504

View in Genome Browser
Species Human (GRCh38)
Location 3:198143718-198143740
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360504_968360512 -6 Left 968360504 3:198143718-198143740 CCCCTCCCTGGCTTGGCCACCCA No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360504_968360519 9 Left 968360504 3:198143718-198143740 CCCCTCCCTGGCTTGGCCACCCA No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360504_968360510 -10 Left 968360504 3:198143718-198143740 CCCCTCCCTGGCTTGGCCACCCA No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360504 Original CRISPR TGGGTGGCCAAGCCAGGGAG GGG (reversed) Intergenic
No off target data available for this crispr