ID: 968360506

View in Genome Browser
Species Human (GRCh38)
Location 3:198143720-198143742
Sequence TGTGGGTGGCCAAGCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360506_968360519 7 Left 968360506 3:198143720-198143742 CCTCCCTGGCTTGGCCACCCACA No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360506_968360512 -8 Left 968360506 3:198143720-198143742 CCTCCCTGGCTTGGCCACCCACA No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360506 Original CRISPR TGTGGGTGGCCAAGCCAGGG AGG (reversed) Intergenic
No off target data available for this crispr