ID: 968360510

View in Genome Browser
Species Human (GRCh38)
Location 3:198143731-198143753
Sequence TGGCCACCCACACCTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360499_968360510 3 Left 968360499 3:198143705-198143727 CCACGTGAGGGCCCCCCTCCCTG No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data
968360502_968360510 -8 Left 968360502 3:198143716-198143738 CCCCCCTCCCTGGCTTGGCCACC No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data
968360496_968360510 25 Left 968360496 3:198143683-198143705 CCTGGCTGCTGATCTCTTGAGGC No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data
968360504_968360510 -10 Left 968360504 3:198143718-198143740 CCCCTCCCTGGCTTGGCCACCCA No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data
968360503_968360510 -9 Left 968360503 3:198143717-198143739 CCCCCTCCCTGGCTTGGCCACCC No data
Right 968360510 3:198143731-198143753 TGGCCACCCACACCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360510 Original CRISPR TGGCCACCCACACCTCCCCT GGG Intergenic
No off target data available for this crispr