ID: 968360512

View in Genome Browser
Species Human (GRCh38)
Location 3:198143735-198143757
Sequence CACCCACACCTCCCCTGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360504_968360512 -6 Left 968360504 3:198143718-198143740 CCCCTCCCTGGCTTGGCCACCCA No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360499_968360512 7 Left 968360499 3:198143705-198143727 CCACGTGAGGGCCCCCCTCCCTG No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360496_968360512 29 Left 968360496 3:198143683-198143705 CCTGGCTGCTGATCTCTTGAGGC No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360506_968360512 -8 Left 968360506 3:198143720-198143742 CCTCCCTGGCTTGGCCACCCACA No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360505_968360512 -7 Left 968360505 3:198143719-198143741 CCCTCCCTGGCTTGGCCACCCAC No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360503_968360512 -5 Left 968360503 3:198143717-198143739 CCCCCTCCCTGGCTTGGCCACCC No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data
968360502_968360512 -4 Left 968360502 3:198143716-198143738 CCCCCCTCCCTGGCTTGGCCACC No data
Right 968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360512 Original CRISPR CACCCACACCTCCCCTGGGC CGG Intergenic
No off target data available for this crispr