ID: 968360519

View in Genome Browser
Species Human (GRCh38)
Location 3:198143750-198143772
Sequence TGGGCCGGCACCTTCTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360502_968360519 11 Left 968360502 3:198143716-198143738 CCCCCCTCCCTGGCTTGGCCACC No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360507_968360519 4 Left 968360507 3:198143723-198143745 CCCTGGCTTGGCCACCCACACCT No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360503_968360519 10 Left 968360503 3:198143717-198143739 CCCCCTCCCTGGCTTGGCCACCC No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360508_968360519 3 Left 968360508 3:198143724-198143746 CCTGGCTTGGCCACCCACACCTC No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360505_968360519 8 Left 968360505 3:198143719-198143741 CCCTCCCTGGCTTGGCCACCCAC No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360504_968360519 9 Left 968360504 3:198143718-198143740 CCCCTCCCTGGCTTGGCCACCCA No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360506_968360519 7 Left 968360506 3:198143720-198143742 CCTCCCTGGCTTGGCCACCCACA No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360513_968360519 -10 Left 968360513 3:198143737-198143759 CCCACACCTCCCCTGGGCCGGCA No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360511_968360519 -7 Left 968360511 3:198143734-198143756 CCACCCACACCTCCCCTGGGCCG No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data
968360499_968360519 22 Left 968360499 3:198143705-198143727 CCACGTGAGGGCCCCCCTCCCTG No data
Right 968360519 3:198143750-198143772 TGGGCCGGCACCTTCTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360519 Original CRISPR TGGGCCGGCACCTTCTTATC TGG Intergenic
No off target data available for this crispr