ID: 968360798

View in Genome Browser
Species Human (GRCh38)
Location 3:198145381-198145403
Sequence GTACAGCTGCTCAACTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968360798_968360804 -8 Left 968360798 3:198145381-198145403 CCCACACAGTTGAGCAGCTGTAC No data
Right 968360804 3:198145396-198145418 AGCTGTACCGTGGGGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968360798 Original CRISPR GTACAGCTGCTCAACTGTGT GGG (reversed) Intergenic
No off target data available for this crispr