ID: 968363562

View in Genome Browser
Species Human (GRCh38)
Location 3:198167141-198167163
Sequence TATAGATAGCAGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968363562_968363567 27 Left 968363562 3:198167141-198167163 CCACACCTGGCCTGCTATCTATA No data
Right 968363567 3:198167191-198167213 GATATTTACCCAGTTTTATTTGG No data
968363562_968363566 -7 Left 968363562 3:198167141-198167163 CCACACCTGGCCTGCTATCTATA No data
Right 968363566 3:198167157-198167179 ATCTATATATTTTATTTGGCTGG No data
968363562_968363568 28 Left 968363562 3:198167141-198167163 CCACACCTGGCCTGCTATCTATA No data
Right 968363568 3:198167192-198167214 ATATTTACCCAGTTTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968363562 Original CRISPR TATAGATAGCAGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr