ID: 968372719

View in Genome Browser
Species Human (GRCh38)
Location 4:10831-10853
Sequence TCTCTGCGCCTGCGCCCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372719_968372723 -8 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372723 4:10846-10868 CGCAGAGACGGACGCCGCCGGGG No data
968372719_968372721 -10 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372721 4:10844-10866 GGCGCAGAGACGGACGCCGCCGG No data
968372719_968372729 27 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG No data
968372719_968372722 -9 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372722 4:10845-10867 GCGCAGAGACGGACGCCGCCGGG No data
968372719_968372724 -2 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372724 4:10852-10874 GACGGACGCCGCCGGGGCGCAGG No data
968372719_968372728 21 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372728 4:10875-10897 CGCAGAGACGGACGCCGCCGCGG No data
968372719_968372727 9 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372727 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372719 Original CRISPR TCTCTGCGCCTGCGCCCCGT CGG (reversed) Intergenic
No off target data available for this crispr