ID: 968372725

View in Genome Browser
Species Human (GRCh38)
Location 4:10860-10882
Sequence TCTCTGCGCCTGCGCCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372725_968372729 -2 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG No data
968372725_968372732 9 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372732 4:10892-10914 CCGCGGCGCAGGCGCAGAGACGG No data
968372725_968372733 21 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372733 4:10904-10926 CGCAGAGACGGACGCCGCCGCGG No data
968372725_968372734 27 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG No data
968372725_968372728 -8 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372728 4:10875-10897 CGCAGAGACGGACGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372725 Original CRISPR TCTCTGCGCCTGCGCCCCGG CGG (reversed) Intergenic
No off target data available for this crispr