ID: 968372726

View in Genome Browser
Species Human (GRCh38)
Location 4:10863-10885
Sequence CCGTCTCTGCGCCTGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372726_968372732 6 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372732 4:10892-10914 CCGCGGCGCAGGCGCAGAGACGG No data
968372726_968372734 24 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG No data
968372726_968372729 -5 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG No data
968372726_968372733 18 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372733 4:10904-10926 CGCAGAGACGGACGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372726 Original CRISPR CCGTCTCTGCGCCTGCGCCC CGG (reversed) Intergenic
No off target data available for this crispr