ID: 968372729

View in Genome Browser
Species Human (GRCh38)
Location 4:10881-10903
Sequence GACGGACGCCGCCGCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372725_968372729 -2 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG No data
968372726_968372729 -5 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG No data
968372719_968372729 27 Left 968372719 4:10831-10853 CCGACGGGGCGCAGGCGCAGAGA No data
Right 968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372729 Original CRISPR GACGGACGCCGCCGCGGCGC AGG Intergenic
No off target data available for this crispr