ID: 968372732

View in Genome Browser
Species Human (GRCh38)
Location 4:10892-10914
Sequence CCGCGGCGCAGGCGCAGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372725_968372732 9 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372732 4:10892-10914 CCGCGGCGCAGGCGCAGAGACGG No data
968372726_968372732 6 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372732 4:10892-10914 CCGCGGCGCAGGCGCAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372732 Original CRISPR CCGCGGCGCAGGCGCAGAGA CGG Intergenic
No off target data available for this crispr