ID: 968372733

View in Genome Browser
Species Human (GRCh38)
Location 4:10904-10926
Sequence CGCAGAGACGGACGCCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372730_968372733 -8 Left 968372730 4:10889-10911 CCGCCGCGGCGCAGGCGCAGAGA No data
Right 968372733 4:10904-10926 CGCAGAGACGGACGCCGCCGCGG No data
968372725_968372733 21 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372733 4:10904-10926 CGCAGAGACGGACGCCGCCGCGG No data
968372726_968372733 18 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372733 4:10904-10926 CGCAGAGACGGACGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372733 Original CRISPR CGCAGAGACGGACGCCGCCG CGG Intergenic
No off target data available for this crispr