ID: 968372734

View in Genome Browser
Species Human (GRCh38)
Location 4:10910-10932
Sequence GACGGACGCCGCCGCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372731_968372734 -5 Left 968372731 4:10892-10914 CCGCGGCGCAGGCGCAGAGACGG No data
Right 968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG No data
968372726_968372734 24 Left 968372726 4:10863-10885 CCGGGGCGCAGGCGCAGAGACGG No data
Right 968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG No data
968372730_968372734 -2 Left 968372730 4:10889-10911 CCGCCGCGGCGCAGGCGCAGAGA No data
Right 968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG No data
968372725_968372734 27 Left 968372725 4:10860-10882 CCGCCGGGGCGCAGGCGCAGAGA No data
Right 968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372734 Original CRISPR GACGGACGCCGCCGCGGCGC AGG Intergenic
No off target data available for this crispr