ID: 968372744

View in Genome Browser
Species Human (GRCh38)
Location 4:10968-10990
Sequence GACGGACGCCGCCGCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372736_968372744 24 Left 968372736 4:10921-10943 CCGCGGCGCAGGCGCAGAGACGG No data
Right 968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG No data
968372740_968372744 -2 Left 968372740 4:10947-10969 CCGCCGCGGCGCAGGCGCAGAGA No data
Right 968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG No data
968372741_968372744 -5 Left 968372741 4:10950-10972 CCGCGGCGCAGGCGCAGAGACGG No data
Right 968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG No data
968372735_968372744 27 Left 968372735 4:10918-10940 CCGCCGCGGCGCAGGCGCAGAGA No data
Right 968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372744 Original CRISPR GACGGACGCCGCCGCGGCGC AGG Intergenic
No off target data available for this crispr