ID: 968372829

View in Genome Browser
Species Human (GRCh38)
Location 4:11298-11320
Sequence CTCCCGCCCCGGCGCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968372829_968372834 -1 Left 968372829 4:11298-11320 CCGGCGCGGCGCCGGGGCGGGAG No data
Right 968372834 4:11320-11342 GCTCCGCGCAGGGGCAGAAAAGG No data
968372829_968372833 -10 Left 968372829 4:11298-11320 CCGGCGCGGCGCCGGGGCGGGAG No data
Right 968372833 4:11311-11333 GGGGCGGGAGCTCCGCGCAGGGG No data
968372829_968372838 17 Left 968372829 4:11298-11320 CCGGCGCGGCGCCGGGGCGGGAG No data
Right 968372838 4:11338-11360 AAAGGACGCTGGCGCGGCGCAGG No data
968372829_968372837 11 Left 968372829 4:11298-11320 CCGGCGCGGCGCCGGGGCGGGAG No data
Right 968372837 4:11332-11354 GGCAGAAAAGGACGCTGGCGCGG No data
968372829_968372836 6 Left 968372829 4:11298-11320 CCGGCGCGGCGCCGGGGCGGGAG No data
Right 968372836 4:11327-11349 GCAGGGGCAGAAAAGGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968372829 Original CRISPR CTCCCGCCCCGGCGCCGCGC CGG (reversed) Intergenic
No off target data available for this crispr