ID: 968373530

View in Genome Browser
Species Human (GRCh38)
Location 4:17615-17637
Sequence AGGAAAACTACAGCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968373525_968373530 8 Left 968373525 4:17584-17606 CCAGACCCTGTCTCAAAAAAAAT 0: 34
1: 623
2: 2762
3: 4716
4: 5507
Right 968373530 4:17615-17637 AGGAAAACTACAGCCTTTGTGGG No data
968373523_968373530 26 Left 968373523 4:17566-17588 CCAGCCTGGGTGACAGAGCCAGA 0: 1990
1: 51987
2: 138461
3: 166166
4: 155611
Right 968373530 4:17615-17637 AGGAAAACTACAGCCTTTGTGGG No data
968373524_968373530 22 Left 968373524 4:17570-17592 CCTGGGTGACAGAGCCAGACCCT 0: 511
1: 7349
2: 40032
3: 106791
4: 173072
Right 968373530 4:17615-17637 AGGAAAACTACAGCCTTTGTGGG No data
968373527_968373530 2 Left 968373527 4:17590-17612 CCTGTCTCAAAAAAAATGTTTTT No data
Right 968373530 4:17615-17637 AGGAAAACTACAGCCTTTGTGGG No data
968373526_968373530 3 Left 968373526 4:17589-17611 CCCTGTCTCAAAAAAAATGTTTT 0: 5
1: 138
2: 547
3: 1731
4: 6638
Right 968373530 4:17615-17637 AGGAAAACTACAGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968373530 Original CRISPR AGGAAAACTACAGCCTTTGT GGG Intergenic
No off target data available for this crispr