ID: 968377513

View in Genome Browser
Species Human (GRCh38)
Location 4:55176-55198
Sequence CGCGCCCGGCCTCCCACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968377507_968377513 12 Left 968377507 4:55141-55163 CCTGCCAAAGTGCTGGGATTACA 0: 1385
1: 300740
2: 267229
3: 151284
4: 133139
Right 968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG 0: 2
1: 0
2: 0
3: 18
4: 239
968377501_968377513 25 Left 968377501 4:55128-55150 CCTCCCGCCTCGGCCTGCCAAAG 0: 105
1: 40562
2: 124213
3: 195061
4: 146798
Right 968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG 0: 2
1: 0
2: 0
3: 18
4: 239
968377503_968377513 21 Left 968377503 4:55132-55154 CCGCCTCGGCCTGCCAAAGTGCT 0: 310
1: 91514
2: 187928
3: 137931
4: 72498
Right 968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG 0: 2
1: 0
2: 0
3: 18
4: 239
968377505_968377513 18 Left 968377505 4:55135-55157 CCTCGGCCTGCCAAAGTGCTGGG 0: 424
1: 119266
2: 267211
3: 214152
4: 127088
Right 968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG 0: 2
1: 0
2: 0
3: 18
4: 239
968377509_968377513 8 Left 968377509 4:55145-55167 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG 0: 2
1: 0
2: 0
3: 18
4: 239
968377502_968377513 22 Left 968377502 4:55131-55153 CCCGCCTCGGCCTGCCAAAGTGC 0: 313
1: 87860
2: 225410
3: 236406
4: 156188
Right 968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG 0: 2
1: 0
2: 0
3: 18
4: 239
968377500_968377513 26 Left 968377500 4:55127-55149 CCCTCCCGCCTCGGCCTGCCAAA 0: 2
1: 36
2: 1090
3: 4999
4: 8919
Right 968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG 0: 2
1: 0
2: 0
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968377513 Original CRISPR CGCGCCCGGCCTCCCACCCA TGG Intronic
900155881 1:1203116-1203138 CCCGCCCAGCCTCCCACTCCAGG - Intergenic
900240468 1:1615132-1615154 CGGGCCCGTCCTCCCGCCCCGGG - Intergenic
900486278 1:2924288-2924310 CAGGCCAGGCTTCCCACCCAGGG + Intergenic
900610733 1:3543566-3543588 CTCGCCCCGCCTCCCGCCCGGGG - Intronic
900991902 1:6101969-6101991 CGCGCCAGGAGTCCCAGCCAGGG - Exonic
901500982 1:9652434-9652456 CGCGCCCCGCCTCCCAGTCCCGG + Intronic
902930289 1:19726310-19726332 CGAGCCAGGCATCACACCCAGGG - Intronic
903353790 1:22734075-22734097 TGCCCTGGGCCTCCCACCCAGGG + Intronic
903366021 1:22805865-22805887 TGGGCTCGGCCTCCCACCCCAGG - Intronic
903897826 1:26620525-26620547 CGCGCCCTCCCTCCCATCCGCGG + Intergenic
904303974 1:29575198-29575220 AGCACCCTCCCTCCCACCCATGG + Intergenic
904908614 1:33917114-33917136 CGGGCCCAGCCCCGCACCCAGGG + Intronic
905028156 1:34865373-34865395 CACCCCCGTCCTCCCACACACGG + Intergenic
905492260 1:38353779-38353801 CGGGCCATGCCTCCCTCCCAGGG - Intergenic
905548540 1:38818288-38818310 GGCGGGCGGCCGCCCACCCAGGG - Intergenic
905819605 1:40979562-40979584 CCCGCCCGGCCTCGAACCTACGG + Exonic
907457185 1:54583220-54583242 GGTGCCCAGCCTCCTACCCAGGG + Intronic
907920027 1:58903710-58903732 GCCGCCCGGCTTCCCGCCCATGG + Intergenic
909463042 1:75941362-75941384 CTCCCCCAGCCTCCCACCAAAGG + Intergenic
912938532 1:114024698-114024720 CGCGCCCGGCCCCGAACCCTGGG - Intergenic
915354096 1:155245421-155245443 CGCGCCTGGCCACATACCCATGG - Intergenic
915399590 1:155612506-155612528 CAGGCCCAGGCTCCCACCCAAGG - Exonic
915416701 1:155748063-155748085 CAGGCCCAGGCTCCCACCCAAGG - Intergenic
919667068 1:200302389-200302411 TGCGCCCGGCCCCGCACCCCCGG + Intergenic
919789701 1:201283335-201283357 GGCGCCCAGCGTCCCACACAGGG + Intergenic
919820432 1:201468869-201468891 CGCGCACGGCCTGCCAGCCCGGG - Exonic
920032999 1:203048542-203048564 CGCACCAGGCCGCCCTCCCAGGG - Intronic
922416545 1:225427827-225427849 CGCGCCAGGCCCCGCGCCCAGGG + Intronic
922720915 1:227899913-227899935 TGCGCCCCGCCTCCTACCCCTGG - Intergenic
1062895867 10:1102699-1102721 CAGGCCCGGCCTCCAACACAGGG + Intronic
1062938997 10:1407797-1407819 CTCGCCCGGCCTCCATCCCCAGG + Intronic
1063443097 10:6089213-6089235 CCCGCCAGGCCACCCACCCGGGG - Intronic
1063504115 10:6580469-6580491 CGCGCCCAGGCTCCCGCCCCTGG + Intergenic
1064252216 10:13715180-13715202 GGCTCCTGACCTCCCACCCAGGG - Intronic
1067469067 10:46523265-46523287 CCCTCCCTGCCTCCCACCCAGGG - Intergenic
1068553457 10:58431931-58431953 CGCACCTGCCTTCCCACCCAGGG - Intergenic
1070288564 10:75100408-75100430 CAGGCCCGGCCACCCCCCCAGGG + Intronic
1072715596 10:97750446-97750468 CACGCCTGCCCTCACACCCACGG + Exonic
1072728006 10:97826500-97826522 TGCACCCAGCCTCCCACCCCAGG - Intergenic
1073325918 10:102643993-102644015 CGCGCCCGGCCAGCCAGCCGGGG + Intergenic
1073363428 10:102918217-102918239 GGTGCCCGCCCTCCCAGCCAGGG - Intergenic
1076412832 10:130264108-130264130 CTGGCCTGGCCTCCCACCCTTGG + Intergenic
1076630738 10:131850475-131850497 AGCGCCCACCCTCCCACCCCAGG + Intergenic
1076663243 10:132069249-132069271 CTCCCCTGGCCTCCCACCCCTGG - Intergenic
1076864372 10:133159964-133159986 CGGGCCCCGCCCCCCACCCCGGG + Intergenic
1076893355 10:133296007-133296029 CTCGCCCCACCTCCCTCCCACGG - Intronic
1077041131 11:523639-523661 CGCGCCCGGCCCCCCAACCCCGG - Intergenic
1077217999 11:1403079-1403101 TCTGCCCGGCCTCTCACCCATGG + Intronic
1077231807 11:1461140-1461162 CGAGCCTGGCCTTCCTCCCACGG - Exonic
1077325712 11:1963104-1963126 CGCCCCCAGCCTCCCACCATGGG - Intronic
1079126431 11:17721193-17721215 CGCGACAAGCCTCCCACCCCCGG - Intronic
1083595619 11:63917248-63917270 CGGGCCCTCCCTCCCACCCCAGG - Intergenic
1083901745 11:65646710-65646732 CGCCCGGCGCCTCCCACCCAGGG - Exonic
1084904371 11:72334657-72334679 CTCCCCTTGCCTCCCACCCAGGG + Intronic
1202808692 11_KI270721v1_random:18283-18305 CGCCCCCAGCCTCCCACCATGGG - Intergenic
1091383590 12:78140-78162 CGCGCACAGCCGCCCGCCCACGG + Intronic
1092201063 12:6583165-6583187 CCGGCCCCGCCCCCCACCCATGG - Intronic
1092791403 12:12073710-12073732 GGCGCACAGCCTCCTACCCAAGG + Intronic
1092861783 12:12725022-12725044 CGCGCCCGGCCTGTCACGCGTGG + Intergenic
1097794201 12:63844545-63844567 CGCGTCCGGCCTCTCCCCCGGGG + Exonic
1101365308 12:104064832-104064854 CGCTCCCCGCCGCCCGCCCAAGG - Intronic
1102084378 12:110124248-110124270 CGCGCCCGTCCTCCCCGCCCTGG + Intergenic
1102254006 12:111405873-111405895 CGCGGCCGGCCTCCCCCGCCGGG + Intergenic
1102394619 12:112575402-112575424 CGCGTCCGGCCGCGCCCCCACGG - Intronic
1102687143 12:114734073-114734095 CCCACCCAGCCACCCACCCAAGG + Intergenic
1102871737 12:116419230-116419252 CGTGCCCGGCCACACATCCATGG - Intergenic
1102960109 12:117086987-117087009 CCCTCCCTGCCTCCCTCCCAAGG - Intronic
1104038903 12:125116754-125116776 CGCGCCCGGCCTCCCGACCTGGG + Intronic
1104568252 12:129903814-129903836 CGAGCCCGGCCACCCGCCCGGGG - Intergenic
1106517043 13:30465008-30465030 CGCGCCCCGCCGCCCCCGCACGG + Intronic
1106776689 13:33016359-33016381 CGCGCCCGCCCGCCCACCGCCGG - Intergenic
1108046267 13:46387301-46387323 CGCCCCCCGCCTCCCACACGGGG + Exonic
1113707805 13:112445625-112445647 CACGCCCGCCCTCCCTCCCCGGG + Intergenic
1113904561 13:113813160-113813182 CTCGCCCGCCCTCCCGCCCTGGG - Exonic
1113961526 13:114128820-114128842 CAGGCCCGGCCTCCCACGGACGG + Intronic
1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG + Intergenic
1116502092 14:45635051-45635073 CGCTCCCCGCCTCCCAGGCAGGG - Intergenic
1116658191 14:47675869-47675891 GGCGCCCAGCCGCCCAACCAGGG - Intergenic
1118783059 14:69022961-69022983 CTCGCTCAGCCTCCCATCCAAGG - Intergenic
1118845923 14:69547865-69547887 CGCGCCCCGCATCCCACGCTGGG + Intergenic
1118971648 14:70642431-70642453 CGCGCCCGGCCTCCCCGGCTGGG + Exonic
1119379292 14:74218422-74218444 GGCCTCTGGCCTCCCACCCAAGG - Intergenic
1119894354 14:78207153-78207175 CGCGCCCGGCCTCCCCACATTGG + Intergenic
1121400695 14:93674446-93674468 GGCACCCTGCCTCTCACCCAAGG + Intronic
1121877161 14:97464010-97464032 CACTCCCCACCTCCCACCCAAGG + Intergenic
1122789752 14:104179215-104179237 CCCGCCCGCCCTGCCTCCCAGGG + Exonic
1125602529 15:40923437-40923459 CGGGCCAGGCCTCCCACCCGGGG + Intergenic
1125857463 15:42964176-42964198 CGTGCCCGGACTGCCACCCATGG - Intronic
1128627254 15:69222315-69222337 CCACCCCTGCCTCCCACCCATGG - Intronic
1129304661 15:74650704-74650726 CGCGCCTGGCCTAACACTCATGG - Intronic
1132592557 16:732504-732526 CGGGCCTGGCCTCCCCACCACGG - Intronic
1132605413 16:791781-791803 CGCTCCCGGCCTAGCAGCCAGGG - Intronic
1132811129 16:1798214-1798236 GGTGCCCTGCCTCCCAGCCATGG + Intronic
1132885717 16:2181147-2181169 CGCCCCCGGCACCCCGCCCAGGG - Exonic
1132931311 16:2460446-2460468 TGCGCCCGGTCTCCCAGCCCTGG - Intronic
1135668350 16:24354383-24354405 CGTGCCTGGGCTCCCACCAAGGG + Intronic
1136529417 16:30857677-30857699 CACGCCCGGCCTCCAAGGCATGG - Intronic
1139476893 16:67207322-67207344 GGGGCCTGGCCTCCCACCCAGGG + Exonic
1140458122 16:75116270-75116292 CGCGCCCCGCCCCCCACGAAGGG - Intronic
1141087548 16:81107695-81107717 CGTGATCGACCTCCCACCCATGG - Intergenic
1141702640 16:85649627-85649649 CTCTCCCGGCCCCCCACCCCTGG + Intronic
1141828152 16:86495141-86495163 TGCACCCGGCCTCCCACCCCTGG + Intergenic
1142260168 16:89039122-89039144 CTCGCCCTGCCTCCTTCCCAAGG + Intergenic
1142434976 16:90050529-90050551 CGCGCCCGGCCGAACACCCCAGG + Intergenic
1143352359 17:6298079-6298101 CCCTCCCAGCCTCCCTCCCAGGG + Intergenic
1143521495 17:7446784-7446806 CCCTCCCGGCCTCCAACCCGGGG + Intronic
1143538930 17:7558220-7558242 CCCGCCCCACCTCCCAGCCAGGG - Intronic
1144085463 17:11804626-11804648 CCCGCCAGGCCTCCCTCCCTGGG - Intronic
1144462060 17:15466324-15466346 AGCGCCCAGGCTCCCACCCCAGG - Intronic
1146053006 17:29567451-29567473 CGCGCGCGGCCGCCGCCCCACGG - Intronic
1147179347 17:38674622-38674644 CGCCCCCGGCCCGCCACCCGGGG + Exonic
1147617115 17:41836129-41836151 CGGGCCCGGACTCCGACCCCCGG - Intronic
1148113539 17:45161427-45161449 CGCGCCCGGACCACCCCCCACGG + Intronic
1148563179 17:48617975-48617997 CGCGCCCGCCTTCGCGCCCATGG + Intronic
1148808850 17:50278016-50278038 AGCCCCCTGCCTCCGACCCAGGG - Intronic
1148818240 17:50346023-50346045 CGCGCCCGGCCCGCCTCCCTAGG + Intergenic
1150638254 17:66931712-66931734 CGCGCCCGCCCCCCAACCCCGGG - Intergenic
1150706934 17:67495347-67495369 CGCGCCCGGCCTCTGAGCCACGG + Intronic
1151966614 17:77434788-77434810 GGCCCCAGGCCTGCCACCCAAGG - Intronic
1152072744 17:78142046-78142068 AGGGCCCGGCCCCCCTCCCAAGG + Exonic
1152132614 17:78486188-78486210 GGGGCCCGGCCACCCACACAGGG - Intronic
1152821351 17:82439332-82439354 AACGACCGGCCACCCACCCAAGG + Intronic
1154159430 18:11969846-11969868 CACGCCCGGCCTCACAGCAACGG + Intergenic
1160532801 18:79575440-79575462 CCCGCCCAGCCGCCCGCCCAAGG + Intergenic
1160791613 19:926083-926105 GGCTCCCGGCCCCCGACCCACGG - Intronic
1160873245 19:1286363-1286385 CGCGCCCGGCCTCGCGCCCCCGG + Intronic
1160919629 19:1513512-1513534 CGCGCCTGGGCTCCCATCCGGGG + Intronic
1161029420 19:2050905-2050927 CCCGCCCGGCCGCCCGCCCTCGG - Exonic
1161065650 19:2236102-2236124 CGGCCCCGGCCTCCCGCCCCTGG + Intronic
1161073426 19:2273623-2273645 AGGGCCCGGCCTCCCAGCCCAGG - Intronic
1161378076 19:3950350-3950372 CGCCCCCCGCCCCCCACCCCAGG + Intergenic
1161510695 19:4669695-4669717 AGGGCCCGGCCTCACACCCTCGG + Intronic
1161673188 19:5625715-5625737 CACGCCCAGCCTCCCACCCCAGG - Intronic
1162794612 19:13080070-13080092 CCCACCCAGTCTCCCACCCAGGG + Intronic
1162798049 19:13096594-13096616 CCCACCCGGCCCCCCACCCCCGG - Intronic
1165469515 19:35995336-35995358 GGCGCCCGGCTTCCCACGCCCGG - Exonic
1166094543 19:40530723-40530745 GGCGCCCGGACCCCCACCCTGGG + Intronic
1166294717 19:41883306-41883328 CCCGCCCGGCCTCCTCCCCTCGG + Intronic
1167493010 19:49802611-49802633 CCCGACCGACCTCCCACCCCAGG - Intronic
1167660803 19:50794901-50794923 CCGGCCCGGCCTCCCGCCCATGG + Exonic
1168029284 19:53666780-53666802 CCCGCCCCCCCTCCCCCCCATGG - Intergenic
1168029620 19:53669264-53669286 CCCGCCCCCCCTCCCCCCCATGG - Intergenic
1168637964 19:58010787-58010809 CCCGCCCTCCCTCCCTCCCACGG + Exonic
1168690042 19:58370948-58370970 CGCGCCCGGCTCCCCCCCCCCGG - Intronic
1168719002 19:58544716-58544738 CGCGCCCCTCCTCCCCCCCTGGG + Exonic
925920110 2:8632540-8632562 CGCCCCCCGCCCCCCACCCCAGG + Intergenic
926758245 2:16253049-16253071 CGCTCCCTGCCTCCACCCCAGGG + Intergenic
927531760 2:23811595-23811617 CTCCCCTGGCCTCCCACCCCCGG - Intronic
928744625 2:34396756-34396778 CGCGTCCGGCCTACCACTGAAGG + Intergenic
929583638 2:43100653-43100675 CGCTCCCTGCCCCCCACCCCGGG + Intergenic
929983027 2:46699016-46699038 CGCGCCCTGCCTCCCTCCTTCGG + Exonic
930741423 2:54836290-54836312 AGCCCATGGCCTCCCACCCAGGG - Intronic
932922391 2:75931551-75931573 CACGCCGAGCCTCTCACCCATGG + Intergenic
937134927 2:119544404-119544426 CGCGCCCGGCCGCCGGCCCTGGG + Intergenic
937247739 2:120504332-120504354 CATGCACGGCCTCCCAGCCAAGG - Intergenic
938672546 2:133599751-133599773 CTCTCCCGGCATCTCACCCAGGG - Intergenic
942325689 2:174775395-174775417 AGCTCCAGGCCTCCCACCCGGGG - Intergenic
945115857 2:206407350-206407372 CTCCCCCAGCCTCCCACCCCAGG + Intergenic
946395574 2:219442215-219442237 CGCGCCCGGCCCGCCGCCCTCGG - Intronic
946727078 2:222671602-222671624 CCAGCGCGCCCTCCCACCCAGGG + Intergenic
948098373 2:235354528-235354550 CCAGCCCTGCCTCCCACCCCTGG + Intergenic
948461356 2:238131387-238131409 CGCGCACAGCCTCCCAGCCGTGG - Exonic
948751525 2:240136118-240136140 CCCGCCCGGCCTCCCCTCCCCGG + Intronic
948844633 2:240677163-240677185 CAGGCCCAGCCTCCCACCCAGGG - Intronic
948849227 2:240697716-240697738 CAGGCCCAGCCTCCCACCCAGGG + Intronic
1168891919 20:1300424-1300446 CAAGCCAGGCCTCCCACACAAGG - Intronic
1172575855 20:36008108-36008130 AGCGCAGGGCCTGCCACCCAGGG + Intronic
1175197502 20:57254524-57254546 CGCCCCCAACCTCCCACACAAGG - Intronic
1176019638 20:62956115-62956137 CTCGCCCGGCCTCCCTCACCAGG + Intronic
1176034531 20:63029777-63029799 CGGCGCAGGCCTCCCACCCAAGG + Intergenic
1176034542 20:63029822-63029844 CGCGCGGGCCCTCCCACCCGAGG + Intergenic
1176178548 20:63739564-63739586 CGGGCCGGGCCTCCCTCCCTAGG + Intronic
1176281566 20:64316586-64316608 CGCGCACAGCCGCCCGCCCACGG - Intergenic
1178951498 21:36989804-36989826 CGCGCCCTGTCCCCCTCCCACGG - Intronic
1181100561 22:20536197-20536219 CTTGCCTGGCCTCCCACCCTGGG - Intronic
1181279382 22:21708191-21708213 CTCGCCCGGCCCATCACCCATGG + Intronic
1182448404 22:30403375-30403397 CCCGCTCTGCCTCCCTCCCAGGG - Intronic
1183163868 22:36132773-36132795 CACGCACGCCCACCCACCCAAGG + Intergenic
1183504606 22:38202285-38202307 CGGGCCCGGGCGCCCACCCCAGG - Intronic
1184101614 22:42344050-42344072 CGCGCCCAGCCCCCCACGCACGG + Intergenic
1184247583 22:43243447-43243469 AGCGCCCGGCCTCCCCTGCAGGG - Intronic
1184729263 22:46364063-46364085 CACGCCCCGGCTCCCTCCCAGGG + Exonic
1184823693 22:46932613-46932635 CGCCCCTTGCCACCCACCCAAGG - Intronic
1185335174 22:50268086-50268108 CCAGCTCGGCCTCCCACCCTCGG + Intronic
950090130 3:10289316-10289338 GGCGCCAGCCCTCCCATCCAGGG + Intronic
950261437 3:11545436-11545458 CGAGCCCTGCCTCCCATCCTCGG + Intronic
950589288 3:13924727-13924749 GGTGCCCGGCATCCCAGCCATGG + Intergenic
953246807 3:41200054-41200076 CCCACCCCGCCCCCCACCCAGGG - Intronic
953606078 3:44414198-44414220 CAAGCCTGGCCTCCCACTCATGG - Intergenic
953888537 3:46733904-46733926 GGCGACCTGCCTCCTACCCATGG - Intronic
954198990 3:49013116-49013138 CGAGCCTTGCCTCCCACCCCAGG - Exonic
954397690 3:50301659-50301681 CGCGCCCGGCCCCCAACCTTGGG - Intronic
960939310 3:122923078-122923100 TTCGCCCAGCTTCCCACCCAGGG - Intronic
968377513 4:55176-55198 CGCGCCCGGCCTCCCACCCATGG + Intronic
968479097 4:826000-826022 CGCGCCCGGCCTCCGCTCCCCGG - Intronic
968513018 4:1003561-1003583 CGCGCCCTGCCCCTGACCCAAGG + Exonic
968549770 4:1216244-1216266 CGGGGCCGGCCTCCCGGCCACGG - Intronic
968616739 4:1580791-1580813 CAGGCCCCGCCTCCCACTCAAGG + Intergenic
969597928 4:8159364-8159386 CGCGCCTCGCCACCCACCCCAGG + Intergenic
969788125 4:9474279-9474301 GGCGCCCGGCCACCCTGCCATGG - Intergenic
981986659 4:150864925-150864947 CGTGCCTGGCCTCCCTCCCAAGG + Intronic
986402545 5:7395311-7395333 CGCGCCCTGCCGCCCTCGCAGGG + Intergenic
990120402 5:52444178-52444200 CCAGCCCGGACTCCCACCCTTGG + Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
997485193 5:134225575-134225597 CGCCCCCTGCCTCCCGCGCAGGG - Intronic
1002649161 5:180679251-180679273 CGTGCCCGGCCTCCGAGCCTGGG + Intergenic
1003212418 6:4079341-4079363 CCCGCCCGGCCTCCCCCGCGGGG + Exonic
1004396160 6:15248253-15248275 CGCGCCCGCCCGCCCAGCCCCGG - Intronic
1006276331 6:33007798-33007820 CTCACCCGGACTCCCGCCCAGGG - Intronic
1006472440 6:34236502-34236524 TGGGCCCGGCCCCCCCCCCAGGG - Intergenic
1006606295 6:35259875-35259897 CCCGCCCGGCCTCCCGCCCTGGG - Intronic
1007320767 6:41027663-41027685 CTACCCCGGCCTCACACCCACGG + Exonic
1008991714 6:57610298-57610320 CGAGGCAGGCCTCCCACCCAAGG - Intronic
1015525994 6:134175641-134175663 CGCGCCCTGCATCTCCCCCATGG + Intronic
1018348876 6:162934308-162934330 AACGCCCGCCCTCCCAACCAGGG - Intronic
1018984360 6:168625086-168625108 CGCCCCCGCCCTTCCTCCCAGGG + Intronic
1019291438 7:252473-252495 CCCCCTCGGCCTCCCAACCACGG + Intronic
1019504510 7:1384026-1384048 CCAGTGCGGCCTCCCACCCACGG - Intergenic
1019601107 7:1884276-1884298 TGCCCCTGGCCACCCACCCATGG + Intronic
1021716543 7:23468032-23468054 CGCCCACGGCCTCCCAACCCCGG + Intronic
1022199401 7:28102051-28102073 GGTGCCCTGCCTCCCACTCAGGG - Intronic
1027171919 7:75878875-75878897 CCGTCCCGGCCTCCCACGCACGG + Intronic
1028128972 7:87147716-87147738 CACGCACTTCCTCCCACCCATGG - Intergenic
1029257231 7:99277761-99277783 CTCGCCCTTCCTCCCTCCCAGGG - Intergenic
1029640296 7:101816106-101816128 CGCGCTCGGCCTCGCGCCCGGGG + Intronic
1030298318 7:107950987-107951009 CTCTCCCGGCCTCACACCCTGGG - Intronic
1032222761 7:130006985-130007007 CCCGCCTGGCCTGCCACCCGAGG - Intergenic
1033641288 7:143264873-143264895 CGCCCTCAGCCTCTCACCCAAGG - Intronic
1034184328 7:149162883-149162905 CGCCCCCCTCCCCCCACCCAGGG - Intronic
1034975766 7:155448635-155448657 CGCGCCCTGGCTCCCACCGCAGG - Intergenic
1035053989 7:156021682-156021704 CCTGCCCGGCCGCCCTCCCATGG + Intergenic
1035299550 7:157887965-157887987 CGCCCCCTGCCTCCCACCCTTGG + Intronic
1037626868 8:20615747-20615769 CGCACTCAGCCTCCTACCCAGGG + Intergenic
1040567799 8:48582657-48582679 CCCCACCGGCCTCCCACCCCTGG - Intergenic
1044857718 8:96493733-96493755 CGCGCCGCGCCTCCCTCCCCGGG - Exonic
1046300201 8:112276897-112276919 GGTGCCCTGCATCCCACCCATGG - Intronic
1049090603 8:140511254-140511276 CGCGCCGGGCCTCGCACTCGGGG + Intergenic
1049109717 8:140635413-140635435 CGCGCCGGGCCCGCCAACCACGG + Intronic
1049369651 8:142257711-142257733 AGGGCCAGGCCTCCCACCCCTGG - Intronic
1049392680 8:142380280-142380302 AGAGCCCGGGGTCCCACCCATGG + Intronic
1049585361 8:143430418-143430440 CGCGCCCGGCCGCGCCCCGACGG + Intergenic
1052816569 9:33106664-33106686 CCCTCCCTGCCTCCCTCCCAGGG - Intronic
1057192723 9:93096391-93096413 CGGGCCGGGCCACCCATCCAGGG - Intronic
1058245957 9:102625610-102625632 CGTGCCCTGCATCCCAGCCATGG - Intergenic
1060182780 9:121545714-121545736 AGCCCCTCGCCTCCCACCCATGG - Intergenic
1060595483 9:124845473-124845495 CGCGCCCGGCCGTGAACCCAAGG + Intergenic
1060598603 9:124862889-124862911 CGCGCCATGCCTTCCAGCCAGGG - Intronic
1061288130 9:129635787-129635809 CCAGCCCGGCCTTCCAGCCATGG + Exonic
1061483624 9:130909233-130909255 CTCTCCCTCCCTCCCACCCAAGG + Intronic
1061618294 9:131794270-131794292 CGGGCTCGGCCTCCCCCACATGG - Intergenic
1061933037 9:133843126-133843148 CGAACCCGGCTTTCCACCCATGG + Intronic
1061987167 9:134136372-134136394 CGCGCGCGGCCGTCCACCGAGGG - Intronic
1062696198 9:137877612-137877634 CGCCCCGCGCCTCCCACCCCGGG - Intergenic
1203571724 Un_KI270744v1:139071-139093 CGCGCCCGGCCTCCCACCCATGG - Intergenic
1186432917 X:9520309-9520331 CGCCCCCCGCCCCCCACCGAGGG + Intronic
1192260942 X:69505523-69505545 CGCTCCCGGCCGGCCCCCCATGG - Exonic
1195197750 X:102516412-102516434 CGCTCCCCGCCTCCCAACCCCGG + Intronic
1199699578 X:150365354-150365376 CACGCCCGGCCTGCCAGCCCTGG + Intronic
1200163254 X:154019792-154019814 CGGGCCCGGCCCCCCGGCCATGG + Exonic