ID: 968378940

View in Genome Browser
Species Human (GRCh38)
Location 4:71959-71981
Sequence ACTCAATGACCACCCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968378940_968378943 -3 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378943 4:71979-72001 AGTATTTCAATGAGCAGGATGGG 0: 1
1: 0
2: 2
3: 16
4: 156
968378940_968378944 -2 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378944 4:71980-72002 GTATTTCAATGAGCAGGATGGGG No data
968378940_968378945 -1 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378945 4:71981-72003 TATTTCAATGAGCAGGATGGGGG No data
968378940_968378941 -8 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378941 4:71974-71996 CATTGAGTATTTCAATGAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 139
968378940_968378947 3 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378947 4:71985-72007 TCAATGAGCAGGATGGGGGTGGG 0: 1
1: 0
2: 45
3: 1893
4: 1392
968378940_968378946 2 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378946 4:71984-72006 TTCAATGAGCAGGATGGGGGTGG 0: 1
1: 0
2: 9
3: 85
4: 2284
968378940_968378942 -4 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378942 4:71978-72000 GAGTATTTCAATGAGCAGGATGG 0: 1
1: 0
2: 1
3: 21
4: 192
968378940_968378950 24 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378950 4:72006-72028 GGAGGATCTATATCATAGGATGG 0: 1
1: 0
2: 1
3: 8
4: 79
968378940_968378948 6 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378948 4:71988-72010 ATGAGCAGGATGGGGGTGGGAGG No data
968378940_968378949 20 Left 968378940 4:71959-71981 CCTTGGGAGGGTGGTCATTGAGT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968378949 4:72002-72024 GGTGGGAGGATCTATATCATAGG 0: 1
1: 0
2: 4
3: 17
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968378940 Original CRISPR ACTCAATGACCACCCTCCCA AGG (reversed) Intronic
903066954 1:20704979-20705001 GCTCAATGCCCACCCACCGAGGG + Intronic
906516086 1:46439617-46439639 CCTCAATTCCCACCATCCCATGG - Intergenic
906649235 1:47500587-47500609 CCCCAATGACCACCTGCCCAAGG + Intergenic
908385663 1:63639043-63639065 ACTCAATGACCACGCTGCTGAGG - Intronic
910363433 1:86438167-86438189 CTTCAATGACCACCCACTCAGGG - Intronic
911090346 1:94012504-94012526 ACTCAGTGCCCACCCTCCAGGGG - Intronic
912952538 1:114130098-114130120 ACTCAAAGGGCACCCTCTCAGGG + Intronic
915119164 1:153617740-153617762 TCTCGGTGACCAGCCTCCCAGGG - Intergenic
917089867 1:171342140-171342162 ATTCAATTACCTACCTCCCACGG - Intergenic
917452546 1:175158878-175158900 ACTAAATGCCCACCCTCCACAGG + Intronic
920865056 1:209744878-209744900 ACTCAAGGACCACCCTCCAGTGG + Intergenic
1064643373 10:17436278-17436300 ATTCAATTACCTCCCCCCCAGGG - Intronic
1067987594 10:51167235-51167257 ACTCAAATGCTACCCTCCCAGGG - Intronic
1069608671 10:69757681-69757703 ACTCAAAGACAACCCTCCTGTGG + Intergenic
1071495843 10:86167219-86167241 ACTGGATGGACACCCTCCCAGGG - Intronic
1071563888 10:86661863-86661885 AGTCACTCACCACCTTCCCAAGG + Intronic
1076265419 10:129105969-129105991 ATCCAATGACCACACTCACAGGG + Intergenic
1076599211 10:131646172-131646194 ACTCGGTGAACACACTCCCATGG + Intergenic
1076671127 10:132121647-132121669 ACTCAGATACCACCCTCCCAGGG - Intronic
1083867741 11:65466617-65466639 ACTCAATGACCAGCCGGGCATGG + Intergenic
1084648351 11:70473795-70473817 CCTCAGTGGCCACCCTCCCGAGG - Intronic
1088499891 11:110472927-110472949 ACTCAACTAACCCCCTCCCAAGG - Intergenic
1088821608 11:113461888-113461910 GCCCAATCACCACCCTCACAGGG + Intronic
1092106470 12:5925173-5925195 ACTCAAGGGCCACCCTACCCTGG + Intronic
1093607952 12:21117182-21117204 ACTCAATGAACACTACCCCAAGG - Intronic
1096258753 12:50078137-50078159 ACCCCAGGACCAGCCTCCCATGG - Intronic
1100675891 12:96867128-96867150 ATTAAATGACCAGCCTCCAAAGG - Intronic
1100931769 12:99618148-99618170 ACTCAAACATCACCTTCCCAGGG + Intronic
1104308158 12:127629042-127629064 ACTCACTGAACACCCGCTCATGG - Intergenic
1104787827 12:131461270-131461292 ACACTATGACCATCCTCCCCAGG + Intergenic
1104870399 12:131991151-131991173 ACACAATGCCCACCCTCCTGGGG - Intronic
1108373920 13:49795920-49795942 ACTCACTCTCCACCTTCCCAAGG + Intergenic
1108750985 13:53448150-53448172 CCTCAAAGTCCACCATCCCAGGG + Intergenic
1111822776 13:93233772-93233794 ACTCACTGACCAGTCTCCCCAGG - Intronic
1121616037 14:95314485-95314507 ACTCCTTGACCACCTTCCCAGGG + Intronic
1122149771 14:99718594-99718616 ACTCAAATACCACCTCCCCAGGG - Intronic
1127364498 15:58275046-58275068 ACTGAAAGACCACGCCCCCAGGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128565649 15:68699156-68699178 TCTCACTGACCACCACCCCAGGG - Intronic
1132362901 15:101232936-101232958 GCCCAATAACCACACTCCCAAGG + Intronic
1141698294 16:85631007-85631029 ACGCAAAGACCACCCCCCCAGGG - Intronic
1143932003 17:10438727-10438749 ATTCAATTACCTCTCTCCCATGG + Intergenic
1144524069 17:15975005-15975027 ACTCGAGGACCACCCTCCAGCGG + Exonic
1147583663 17:41640143-41640165 ACTCAATAACAAGGCTCCCAGGG - Intergenic
1156522994 18:37737685-37737707 ACTCAATCACCCTCCTCCCTGGG - Intergenic
1158794732 18:60830832-60830854 AGTCAACAACCACCCTCCAAAGG + Intergenic
1160436311 18:78855344-78855366 ACTCCATGACCACCATCCACTGG + Intergenic
1165103713 19:33456405-33456427 ACTCAAGGACTGCCCTCCTAGGG + Intronic
1167271724 19:48509990-48510012 ACGCCATGACCAGCATCCCATGG - Intronic
1168598571 19:57699626-57699648 ACTCAATGTCAACCATTCCACGG + Exonic
929031119 2:37650683-37650705 ATTTAATGAGCACCCTCCCTGGG + Intronic
929592072 2:43153920-43153942 ACTCCCTGACCACCCACCCATGG - Intergenic
933004054 2:76967451-76967473 ACTCAGTGATCCTCCTCCCAGGG + Intronic
933165734 2:79072572-79072594 ACTCAGTGCCCCTCCTCCCAGGG - Intergenic
948811022 2:240478503-240478525 ACACAGTTACGACCCTCCCAGGG + Intergenic
949042086 2:241854149-241854171 CCTCACTGGGCACCCTCCCAGGG + Intronic
1169193928 20:3673505-3673527 CCGCAGTGACCGCCCTCCCACGG - Intronic
1170751054 20:19145470-19145492 ACACAGTCACCACCCTCCAAGGG - Intergenic
1171521873 20:25782441-25782463 CCCCAATCACCACCCTCCCCAGG + Intronic
1171554952 20:26073442-26073464 CCCCAATCACCACCCTCCCCAGG - Intergenic
1171786801 20:29473669-29473691 ACATAATGACCACCCCCCAAAGG - Intergenic
1172409210 20:34709645-34709667 TCTCAAAGGCAACCCTCCCAAGG - Intronic
1180260520 21:46665559-46665581 ACTCAGTGCCCACCCTCTCAAGG + Intergenic
1181556726 22:23675566-23675588 ACACATTGACCAGCCTCCCAGGG - Intergenic
1181697662 22:24602019-24602041 ACACATTCACCAGCCTCCCAGGG + Intronic
1182000093 22:26913197-26913219 ACTCAATGATCCCCTTCCCTAGG + Intergenic
1183731757 22:39622348-39622370 ACTCAATCCCCATCCTCCCCTGG - Intronic
950046165 3:9949739-9949761 GCTCAAGGACCAAGCTCCCACGG - Exonic
951539836 3:23772042-23772064 ACCCACTGACCACCCTCCTCTGG - Intergenic
954590061 3:51775674-51775696 ACTCCATCCCCACCCTGCCAGGG - Intergenic
956894296 3:73643991-73644013 ACACAATTACCACCCACCAAAGG + Intergenic
960877081 3:122307825-122307847 ACTCAATGTGCATCCCCCCAGGG - Intergenic
968378940 4:71959-71981 ACTCAATGACCACCCTCCCAAGG - Intronic
969197872 4:5577509-5577531 GATCAAGGACCACCCTCTCATGG - Intronic
971364294 4:25965201-25965223 ACTCAATGCCCCCCATTCCAGGG + Intergenic
972694231 4:41429095-41429117 ACTCAAGCACCACTCTCCCTCGG - Intronic
978030400 4:103934834-103934856 ACCCAATGACCAACCTCTCCTGG - Intergenic
978776404 4:112510508-112510530 ACACAATGAACCCCCTGCCAGGG + Intergenic
993170674 5:84415194-84415216 ACCCACTGACTACCCTTCCAGGG + Intergenic
994631212 5:102290387-102290409 ACTCACTGACCCCATTCCCAGGG + Intronic
996963659 5:129281993-129282015 ACTCAAAGACCACTCTCTAATGG + Intergenic
997383587 5:133455121-133455143 ACTCAACCACAAACCTCCCAAGG - Intronic
999539497 5:152556235-152556257 ACTCAAAGGCCATCTTCCCAAGG - Intergenic
1000975020 5:167755164-167755186 ACTCCATCACAACCTTCCCATGG - Intronic
1002158190 5:177299403-177299425 ACTCAATGGCCACCTTCACCTGG - Exonic
1006934231 6:37706014-37706036 CCTCCATGCCCACCATCCCAGGG + Intergenic
1007702883 6:43774727-43774749 ACTAAATGTCCACTCTCCCCTGG - Intronic
1008486952 6:52046815-52046837 ACCCAATGACCCACCTCACAGGG - Intronic
1009878778 6:69539339-69539361 GCTCTATGACCAACCTCCCTTGG + Intergenic
1011459531 6:87589162-87589184 ACTCATTGGCCACCCTTGCAAGG - Intronic
1013702992 6:112796450-112796472 ACTCACTGAAGACCCTCCCCGGG - Intergenic
1014662043 6:124184564-124184586 ACTCTCTGACTGCCCTCCCAGGG + Intronic
1019516561 7:1442713-1442735 TCCCAATGACCACCCTGGCAAGG + Intronic
1022408928 7:30121210-30121232 ACTTTCTGACCAACCTCCCATGG - Intronic
1034413677 7:150954231-150954253 ACTGAAGGGCCACCCACCCATGG - Intronic
1034918344 7:155059269-155059291 AATCAATGACCATCTTCCCATGG + Intergenic
1039397874 8:37242797-37242819 ACTAAATGACCAGCCTCTTAGGG - Intergenic
1039399626 8:37258397-37258419 ACTCTATGTTCACCCTCCCAGGG + Intergenic
1045082836 8:98647230-98647252 ACTCAAATATCACCTTCCCAAGG + Intronic
1047178831 8:122567877-122567899 ATACACTGAGCACCCTCCCAAGG + Intergenic
1048966080 8:139615613-139615635 ACTCAGTGACCATCCTTCAAAGG + Intronic
1049298901 8:141859320-141859342 ACTCAAGGACCACCTCCCCCAGG - Intergenic
1049387073 8:142348495-142348517 ACCCCATGCCCACCCTCCCCTGG + Intronic
1049387101 8:142348563-142348585 ACCCCATGCCCACCCTCCCCTGG + Intronic
1049387129 8:142348631-142348653 ACCCCATGCCCACCCTCCCCTGG + Intronic
1050685469 9:8163761-8163783 ACACACAGACCACCCACCCATGG - Intergenic
1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG + Intronic
1051586729 9:18734430-18734452 AGAAAATGCCCACCCTCCCAAGG - Intronic
1052034831 9:23668753-23668775 GCACAATTAGCACCCTCCCAAGG + Intergenic
1052245533 9:26329684-26329706 CATCAATGCCCAGCCTCCCAGGG + Intergenic
1056740595 9:89251202-89251224 TCTCTCTGCCCACCCTCCCATGG + Intergenic
1056769251 9:89465042-89465064 ACTCACTGACCAACCTGTCAGGG + Intronic
1057157239 9:92853758-92853780 AGGCAATGACCACCCCCACAGGG - Intronic
1059463360 9:114449486-114449508 GCGCAATTACCACCCTACCAAGG + Intronic
1060260330 9:122068985-122069007 CCTGAATGACGACCCTGCCAAGG + Intronic
1060965129 9:127707936-127707958 ACTCAGTGAGCACCAGCCCATGG - Intronic
1186562046 X:10622908-10622930 ACTCAATGAACATTCTCCAAAGG - Intronic
1188860057 X:35244891-35244913 ACACACTGCCCACCCTGCCAAGG - Intergenic
1192690360 X:73356246-73356268 AATATATAACCACCCTCCCAGGG + Intergenic
1193140195 X:78018979-78019001 ACTCAATCACCTCCCTCCCTTGG + Intronic