ID: 968380216

View in Genome Browser
Species Human (GRCh38)
Location 4:88176-88198
Sequence CCAAAGTCTGCATTTATTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968380216_968380218 -8 Left 968380216 4:88176-88198 CCGCAAATAAATGCAGACTTTGG 0: 1
1: 0
2: 1
3: 17
4: 242
Right 968380218 4:88191-88213 GACTTTGGTTTTGATTTACATGG 0: 1
1: 1
2: 3
3: 24
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968380216 Original CRISPR CCAAAGTCTGCATTTATTTG CGG (reversed) Exonic
902429347 1:16351430-16351452 CCAGAGTCTGGATTTTTCTGTGG - Intronic
902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG + Intergenic
903073532 1:20743203-20743225 CTAGATTCTACATTTATTTGTGG - Exonic
906553494 1:46687521-46687543 CCAGAGTTTGACTTTATTTGTGG + Intronic
907928589 1:58978098-58978120 ACAAAGTCTGCTTTTAATTAGGG + Intergenic
907955383 1:59223335-59223357 CCAAAGACTGCATGAATTTCAGG - Intergenic
910125837 1:83841195-83841217 CCAAAGTCTGGTTACATTTGGGG + Intergenic
910155478 1:84213461-84213483 CAAAAATCTTCACTTATTTGGGG + Intronic
911537469 1:99117787-99117809 CCAAATTATCCATTTATTTTGGG + Intergenic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
913035101 1:114956856-114956878 GCACAGTCTGCCTTTGTTTGTGG - Intronic
920406502 1:205717183-205717205 CCATGCTCTGCTTTTATTTGGGG - Exonic
921661152 1:217804236-217804258 CAAATGTGTGCATTTATTTCTGG - Intronic
923955766 1:239018397-239018419 CCCAGGTCTGCATTAATTTGAGG - Intergenic
924135599 1:240963186-240963208 GCAAAGTCTGCACAGATTTGGGG + Intronic
1064730804 10:18328888-18328910 CCAAAGACTGTATTTATGTTGGG + Intronic
1064893915 10:20211859-20211881 CCAATGTCTGCAAATATTAGGGG + Intronic
1064893918 10:20211951-20211973 CCCATGTCTGCATCTATTAGGGG - Intronic
1067284997 10:44901484-44901506 CCAAAGTCAGCTGGTATTTGAGG - Intergenic
1067765764 10:49084984-49085006 CCAATGTCTGCATGTATCTTTGG - Intronic
1068387698 10:56352753-56352775 CCACAGTCTCCATTTGTATGAGG - Intergenic
1068540210 10:58284168-58284190 CTAATTTCTGCATTTTTTTGTGG - Intronic
1068723925 10:60279453-60279475 TTAAAGACTTCATTTATTTGTGG - Intronic
1070716046 10:78721922-78721944 CAAAAGTCTGGAATAATTTGGGG + Intergenic
1070752285 10:78971376-78971398 CCAAACTCCCCAGTTATTTGAGG + Intergenic
1070764709 10:79049617-79049639 GCAAAGTCTATCTTTATTTGCGG - Intergenic
1071591519 10:86878846-86878868 CCAAACTCTGATTTTGTTTGGGG - Intronic
1071882579 10:89915601-89915623 CCTAAGTCTGTATTTCTTTAGGG + Intergenic
1072449951 10:95532012-95532034 TCCATGACTGCATTTATTTGTGG - Intronic
1073751723 10:106536041-106536063 ACAAGGTCTGCATTTGTTTCAGG - Intergenic
1075618281 10:123907389-123907411 CCTAAAACTGCATTTACTTGGGG + Intronic
1075760421 10:124851204-124851226 CAGATGTCTGCATATATTTGGGG + Intergenic
1075788999 10:125069940-125069962 CCAAAGTCTGTAGTTACTTAGGG - Intronic
1079022312 11:16919254-16919276 CCAAAGTGTGCAATGATATGGGG - Intronic
1079279242 11:19072927-19072949 CCAAACTGTGCAGTTATCTGTGG - Intergenic
1079772311 11:24477024-24477046 TCAAAGTTTGGATTTATATGAGG - Intergenic
1084609962 11:70195777-70195799 CAAAAGTGTGTATTTTTTTGTGG - Intergenic
1085141568 11:74148531-74148553 CAAAAGTCTGAATATATTTTTGG + Intronic
1085622297 11:78046449-78046471 CCAGAGTTTGCAGTTCTTTGGGG + Intronic
1086056093 11:82648599-82648621 TCAAAGTTTGCATTACTTTGTGG + Intergenic
1086177845 11:83913760-83913782 CAAAAGTCTCCCTTTCTTTGAGG - Intronic
1087201919 11:95353982-95354004 GCAAAGGTTGCAGTTATTTGAGG + Intergenic
1088593760 11:111424514-111424536 CCAAATAATTCATTTATTTGAGG + Intronic
1089678630 11:120107245-120107267 GCAAATTCTGCATTTTTCTGAGG - Intergenic
1089824914 11:121266210-121266232 CATAAGACTGCACTTATTTGAGG - Intergenic
1090238477 11:125165864-125165886 TCAAAGTTTGCATTTCTTTCGGG + Intronic
1090561265 11:127935361-127935383 CCAAAGTCTACATTTTTGTAAGG + Intergenic
1091066072 11:132514493-132514515 GCAGAGTCTGCTTTTCTTTGTGG + Intronic
1091560807 12:1611535-1611557 CAATAGCATGCATTTATTTGTGG + Intronic
1091825692 12:3511050-3511072 CCATTGTCTCCATTTATTTAAGG - Intronic
1092402530 12:8188858-8188880 CCAGAGTCTGCATCCATTTCTGG - Intergenic
1093540039 12:20271516-20271538 GCAAAGTCTTCAATTAGTTGAGG + Intergenic
1093759809 12:22896286-22896308 GCAAAATCTGCATTTAATTTTGG - Intergenic
1095589500 12:43887997-43888019 CCAAAGTTAGCCTCTATTTGGGG + Intronic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1096947676 12:55425979-55426001 CCATAGTTTACATTTATTTTGGG - Intergenic
1097720816 12:63018878-63018900 ACACAGGCTGCATTTATCTGGGG + Intergenic
1098509000 12:71289998-71290020 CAGAAATCTGCATTTCTTTGGGG + Intronic
1099472258 12:83065801-83065823 CCAAATTCTGCATTAACTTATGG + Intronic
1103842169 12:123873968-123873990 CTAAATTCAGCATGTATTTGAGG + Intronic
1104039107 12:125118012-125118034 CAAAGGTCTCCATTTAGTTGAGG - Intronic
1104130580 12:125889923-125889945 ACAAAGTCTGCCTTTAAATGTGG + Intergenic
1104457424 12:128926819-128926841 CCAAAGTCCACATTGAATTGGGG + Intronic
1106114356 13:26804108-26804130 CCAAGGCTTGCTTTTATTTGAGG - Intergenic
1106342864 13:28847828-28847850 CCAGAGGCTGCATCTATGTGAGG - Intronic
1107873649 13:44769738-44769760 CCACAGTCTGCTTTTTATTGGGG - Intergenic
1110034098 13:70656904-70656926 CCAAAATCAGCATTTATTTAAGG + Intergenic
1111031528 13:82606121-82606143 CCAATGTCTCAATTTATTTCTGG + Intergenic
1111346839 13:86968145-86968167 CCAAATTTTCCATTTATTTCTGG - Intergenic
1112523054 13:100115373-100115395 CTACAGTCTGCAGTAATTTGTGG + Intronic
1114164622 14:20208274-20208296 CAAAACTCTGCATTTGTTTATGG + Intergenic
1115413167 14:33099364-33099386 CAAAATTCTGCATGTATTTCAGG + Intronic
1117042810 14:51782368-51782390 CCTAAGTTTTCATTTCTTTGGGG + Intergenic
1119713949 14:76845025-76845047 CCAAATTCTGAATGTATTTTGGG - Intronic
1120081212 14:80218674-80218696 CCAAACACTGCATTTTGTTGAGG - Intronic
1120464341 14:84837379-84837401 CCACTTTCTGCATTTATTTAGGG - Intergenic
1120792088 14:88593557-88593579 TGAAAGTATGCATTTATTTCTGG - Intronic
1121555412 14:94832693-94832715 CCCAAGTATCCATTTATTTATGG + Intergenic
1125072035 15:35566754-35566776 TCACAATCTGCTTTTATTTGTGG - Intergenic
1125399001 15:39280435-39280457 ACAAATTGAGCATTTATTTGAGG + Intergenic
1127310521 15:57747960-57747982 CTAAAGACAGCATTTATTTTCGG - Intronic
1130760074 15:86810088-86810110 CCCAAGTTTGAACTTATTTGAGG - Intronic
1131801787 15:96076956-96076978 CCAAACTATGCATTTATTAAGGG + Intergenic
1132420778 15:101665974-101665996 CCAATGTTTGCATTTATTGGAGG - Intronic
1133262530 16:4560542-4560564 CCAATCTCTGCTTTTTTTTGTGG - Intronic
1134542691 16:15080778-15080800 CCAAGGTCTTCATTTTTTAGGGG - Intronic
1135360280 16:21806912-21806934 CCAAGGTCTTCATTTTTTAGGGG - Intergenic
1135510060 16:23074883-23074905 TAAAAATATGCATTTATTTGGGG + Intronic
1136219094 16:28816470-28816492 CAAAAGTTTTCACTTATTTGTGG - Intergenic
1138022227 16:53495039-53495061 ACACAGTCTGGCTTTATTTGTGG - Intronic
1140247702 16:73266256-73266278 ACATATTCTGCATTTATTTGTGG + Intergenic
1140548397 16:75835307-75835329 CCAAAATCTGCATTTGTTTCTGG + Intergenic
1141774831 16:86116332-86116354 GCAATGTCTGCATTTCTTTTGGG + Intergenic
1143802611 17:9396859-9396881 TCACAGTCTGCATTTATTGCTGG - Intronic
1144655831 17:17035923-17035945 ACAAAGTATATATTTATTTGGGG + Intergenic
1144864967 17:18329687-18329709 CCAGAGGCTGCATTTCTCTGTGG - Intronic
1146450870 17:32972914-32972936 CCAAAGTCAGCACTCTTTTGGGG + Intronic
1146564939 17:33904643-33904665 CCAAAGGCAGCACTTATCTGTGG - Intronic
1157322101 18:46642498-46642520 CCAAGGTCTGCATCTACTTGGGG - Intronic
1159791716 18:72789702-72789724 CCAAGGTCTGTATTTTCTTGAGG + Intronic
1160412469 18:78684253-78684275 CCAAAATCTGAGTGTATTTGAGG - Intergenic
1163414716 19:17179191-17179213 CCAATGTCTGCAGACATTTGTGG - Intronic
1165564373 19:36711824-36711846 CCAAAAACTGTATTTATTTATGG - Exonic
926883701 2:17577541-17577563 ATAAATTCTGCATGTATTTGAGG + Intronic
926962051 2:18367942-18367964 CAATAGTCTGAATTTATTTCTGG + Intergenic
927350811 2:22111898-22111920 ACAAAGTATGCATTTACTTCTGG - Intergenic
929199492 2:39220078-39220100 ACAAAGACTGAATTTATGTGAGG + Intronic
930294108 2:49531592-49531614 CCAAAGTCTCCTTTTCTTTAAGG - Intergenic
930464554 2:51731103-51731125 CCAGAGTCTGCATTTCTTTCTGG + Intergenic
930932650 2:56906142-56906164 CAAAAGTCTGCATTTGCTTTTGG - Intergenic
931757357 2:65385822-65385844 CGCAGGTCTGCATTTATTAGGGG - Intronic
931991809 2:67797708-67797730 CAAAAGTTTGCATTTATTTCTGG + Intergenic
932468810 2:71940491-71940513 CCAAACTCTTCATTTTGTTGGGG + Intergenic
932994195 2:76829136-76829158 CCAAAGTCTGCTTCCACTTGAGG + Intronic
933326639 2:80846280-80846302 ACAAAGTCTTCATTTACTTCTGG - Intergenic
933340051 2:81012769-81012791 CCAAATTCTGCAAGTATTTTTGG + Intergenic
933517444 2:83323388-83323410 CTAAACTCTGCCTTTATTTATGG - Intergenic
934585151 2:95485810-95485832 GCAAAGTCTTCCTTTCTTTGGGG - Intergenic
934594311 2:95590923-95590945 GCAAAGTCTTCCTTTCTTTGGGG + Intergenic
935230569 2:101092232-101092254 CCAAAGTCTGGGTTTGTCTGAGG + Intronic
935734212 2:106093837-106093859 GCAAAATCTGCAGTTTTTTGAGG + Exonic
937924988 2:127161212-127161234 CTCAAGTCTGCCCTTATTTGGGG + Intergenic
938888852 2:135682211-135682233 CCAAAGTCATCATTTCTATGTGG + Intronic
939681242 2:145136298-145136320 TCAAAATTTGCATTTATATGAGG - Intergenic
940734379 2:157432601-157432623 CCAAAGTCTGCATTCCTATTGGG + Intronic
942540507 2:177010236-177010258 TCTAAGTCTGCCTTTCTTTGTGG + Intergenic
942809155 2:179976083-179976105 CCAATGTCTGGATTTATCTCTGG - Intronic
942872251 2:180749261-180749283 CCAAAGTCTAAAATTTTTTGTGG + Intergenic
943877621 2:193092171-193092193 CAAAAGTTTGCATTTTTTTAAGG - Intergenic
946112779 2:217434761-217434783 ACACAGTCTGCAACTATTTGGGG + Intronic
946888497 2:224248775-224248797 CTAAAGTTTGCAGTCATTTGGGG - Intergenic
1169678808 20:8186151-8186173 CCAAAGTTTGGATTTCTTTTTGG + Intronic
1169707773 20:8525362-8525384 TCAAGGTTTGCATTTATTTGGGG + Intronic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1176612591 21:8998097-8998119 CCAAAGTGAGTCTTTATTTGGGG + Intergenic
1176712531 21:10165344-10165366 CCAAAGTGAGTCTTTATTTGGGG - Intergenic
1177716936 21:24851200-24851222 CAAACGTCTGTAATTATTTGAGG - Intergenic
1177961882 21:27677683-27677705 CCAAAGTATTCAATTATTTGAGG - Intergenic
1178246524 21:30958010-30958032 AATAAGTCTGCAATTATTTGTGG + Intergenic
1178516311 21:33250514-33250536 TCAAATTCTGCATATATTTTGGG + Intronic
1179670131 21:42941075-42941097 CCAAAGTCTGTTTTTCTTGGCGG + Intergenic
1180362948 22:11916125-11916147 CCAAAGTCTTAACTTATTTCAGG - Intergenic
1180829059 22:18888727-18888749 CCAACATCTGCATGTATGTGTGG - Intergenic
1182200527 22:28564429-28564451 CAAAAGTCTGAATTTAGTGGTGG - Intronic
1182996262 22:34815682-34815704 ACTAAGTCTGCATCTCTTTGTGG - Intergenic
1203279150 22_KI270734v1_random:114714-114736 CCAACATCTGCATGTATGTGTGG - Intergenic
949268035 3:2183654-2183676 CAAAATTCTTAATTTATTTGAGG - Intronic
949320864 3:2809078-2809100 CCACAGTGAGCTTTTATTTGGGG + Intronic
950014072 3:9743926-9743948 CCAAAGTCTGACTTGCTTTGGGG - Intronic
951081185 3:18451883-18451905 CAATAGTCTTCCTTTATTTGAGG - Intergenic
952286684 3:31976449-31976471 CTAAAGTAGACATTTATTTGGGG - Intronic
955712103 3:61791236-61791258 ACAAAGTCAGCATTTATCTCAGG + Intronic
957770483 3:84685880-84685902 CCACAGTAAGCATTTATTTTAGG + Intergenic
957840925 3:85668349-85668371 CCAAACACTAGATTTATTTGAGG - Intronic
957912898 3:86645462-86645484 CCTAAATCTGCATTAATTTGGGG + Intergenic
957927281 3:86830495-86830517 CCACAGTCTTCATTTTATTGAGG + Intergenic
957975200 3:87434163-87434185 CCAAAGTATGCATTTTCATGGGG - Intergenic
960303780 3:116036283-116036305 CCAAAGTCTCCATTCAATGGAGG - Intronic
962104720 3:132378904-132378926 CCAAAGTGTACAGTTATCTGTGG + Intergenic
963635390 3:147788459-147788481 CTATAGTTTTCATTTATTTGTGG - Intergenic
965944382 3:174222460-174222482 ATAAAGTGTGCATTGATTTGTGG - Intronic
966634982 3:182122950-182122972 CCAGCATCTGCATTTATTTATGG - Intergenic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
969409334 4:7017844-7017866 CCTGAGTCAGCATTTATTGGTGG + Intronic
970114914 4:12684084-12684106 CCAAAGTCTGCTCTCTTTTGAGG + Intergenic
970545942 4:17130579-17130601 CCAATGTCTACATTTTTTGGAGG - Intergenic
971033603 4:22668458-22668480 CCAAAGTGTACATATGTTTGAGG - Intergenic
973007692 4:45033232-45033254 CCAAAGACAGCCTTTATCTGAGG + Intergenic
973379213 4:49308841-49308863 CCACATTCTGCGTTTTTTTGGGG - Intergenic
973385410 4:49510625-49510647 CCACATTCTGCGTTTTTTTGGGG + Intergenic
974921340 4:68244038-68244060 CCAGAGGCTACATTTATTAGAGG - Intronic
975397178 4:73890039-73890061 CCAAAATTTGTATATATTTGAGG + Intergenic
977738350 4:100444930-100444952 GCAAAGACTGCATGTATCTGTGG + Intronic
979095815 4:116549399-116549421 ACAAAATATGCATGTATTTGGGG - Intergenic
980312169 4:131144978-131145000 ACAAAGTTTTCACTTATTTGTGG + Intergenic
983511470 4:168613537-168613559 CCAAAATCTGCATCCATTTCTGG - Intronic
984950493 4:185004311-185004333 CCAAAGGCTGTTTTTACTTGGGG - Intergenic
986031519 5:3898397-3898419 CCAAAGGCTTCCCTTATTTGGGG - Intergenic
987059283 5:14226598-14226620 CCAAATTATGCATTTATAAGAGG + Intronic
989264319 5:39455551-39455573 CCAATCTCTGGATTTATTGGGGG - Intronic
990152911 5:52840596-52840618 GCAAAGCAGGCATTTATTTGTGG + Intronic
993467023 5:88261178-88261200 CCAAAGTATTCATTTTTTTCTGG - Intronic
993701983 5:91129448-91129470 TTAAAGTCTGCCTTTATTTTGGG + Intronic
994005527 5:94832739-94832761 ACAAAGTCTGAATTTATTGTGGG + Intronic
994058437 5:95446476-95446498 AAAAAGTCTGCAGTTTTTTGAGG - Intronic
994841216 5:104927654-104927676 CTGAAGTCTGCATTCATTTTTGG - Intergenic
995845265 5:116487261-116487283 ACAAAGTGTGCTTTTGTTTGAGG - Intronic
996221656 5:120940171-120940193 CCAAAATCTGCTTAGATTTGGGG + Intergenic
996297856 5:121944423-121944445 CTAAATTCTGCATTTTTATGAGG + Intergenic
997668052 5:135648113-135648135 TCAAACTCTGCACTAATTTGGGG - Intergenic
998977101 5:147660571-147660593 CTAAAGTCAGCATGTTTTTGTGG - Intronic
999801529 5:155042722-155042744 CCAATCTCTGCTTTTATTTTTGG + Intergenic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1001647530 5:173293416-173293438 CCAAAGTCTGGAATACTTTGAGG - Intergenic
1004748607 6:18538078-18538100 CTAAAGTCAGCATATATTTTCGG + Intergenic
1005441993 6:25880043-25880065 CAAAGGTCTTCATTTATTTTGGG - Intronic
1006124807 6:31830598-31830620 AAAAAGTCAGCATTTTTTTGTGG - Intergenic
1006335143 6:33416553-33416575 CCAAAGACGGGATTTATTGGGGG + Exonic
1006628644 6:35415282-35415304 CCAAATTCTGCAGGGATTTGAGG - Intronic
1007955086 6:45910891-45910913 TCAGAGTCTCCATTTATTTCTGG + Intronic
1009596328 6:65741416-65741438 CCAAGCTTTGCATTTAGTTGGGG - Intergenic
1009720291 6:67459813-67459835 TTTAAGTCTGCATTTATCTGTGG - Intergenic
1011832853 6:91394102-91394124 GCTAACTCTGCATTTGTTTGTGG + Intergenic
1012341583 6:98131701-98131723 CTAAAGCCTTCATTGATTTGGGG - Intergenic
1013841107 6:114395071-114395093 CAAAATACTGCATATATTTGAGG + Intergenic
1013841126 6:114395433-114395455 CAAAAGACTTCATATATTTGAGG + Intergenic
1014487543 6:122018206-122018228 CCAAAGTGTGCAACTATTTGGGG - Intergenic
1016052529 6:139544863-139544885 CAAAAGTGTGCCTTTATTTTTGG - Intergenic
1016173869 6:141053723-141053745 CAAATGTCATCATTTATTTGGGG - Intergenic
1017791949 6:157807741-157807763 CCAGAGTCTTAGTTTATTTGGGG - Intronic
1018766917 6:166941240-166941262 GCACAGTATGCATTTATTTTTGG - Intronic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1019302003 7:310117-310139 GCAAAGTCTGAATATATTTTTGG + Intergenic
1020798516 7:12704830-12704852 CACATGTCTGCACTTATTTGTGG - Intergenic
1020964460 7:14847661-14847683 TCACAGTTTGCATTTATTTATGG - Intronic
1021432891 7:20581821-20581843 ACAAGGTCTGCATTTTTTAGAGG + Intergenic
1026979451 7:74517993-74518015 ACAAAGTCTGCAGTTATGAGGGG + Intronic
1027478348 7:78662114-78662136 CCCAAGGCTTTATTTATTTGGGG + Intronic
1027544375 7:79507924-79507946 TCTATGTCTGAATTTATTTGGGG + Intergenic
1031385266 7:121142093-121142115 CCCAAGTCTGCCCTTGTTTGAGG + Exonic
1031784874 7:126016851-126016873 CCAAAGAATGCATTTTATTGAGG - Intergenic
1032217539 7:129969240-129969262 GCAAATTATGCATTTACTTGAGG + Intergenic
1032574618 7:133040132-133040154 TCTAAGTCTGCATGTTTTTGAGG - Intronic
1032617862 7:133494694-133494716 CCAAATTCTGTATCTATTTTAGG - Intronic
1034188953 7:149198953-149198975 CCACAGTCTGCATTTCTGTCTGG + Intronic
1036479972 8:9131114-9131136 CCAGAGTCCACATTTATTTTGGG + Intergenic
1036539160 8:9686866-9686888 CCAAATTCTTCATTTTTTTTAGG - Intronic
1039727584 8:40236156-40236178 CCAAAGACTGACTTTATTTTAGG + Intergenic
1040984286 8:53277021-53277043 CCCAAGTCTGTATTTGTTTGGGG + Intergenic
1041283885 8:56240422-56240444 CCAAAGTTTGCAATTATTTTTGG - Intergenic
1042568281 8:70134787-70134809 TTAATCTCTGCATTTATTTGGGG - Intronic
1045667619 8:104506619-104506641 CCACAGCCTGAATTTATATGGGG - Intronic
1046226971 8:111294914-111294936 TCAAAATCTGCATATATTTTTGG + Intergenic
1046428973 8:114096991-114097013 GCACAGTCTGCATTCATTTCTGG - Intergenic
1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG + Intergenic
1051832433 9:21295314-21295336 TCAACGTCTGCTTTAATTTGTGG + Intergenic
1055031944 9:71779207-71779229 CAAATGGCTGCATTTATTGGTGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057384094 9:94592299-94592321 CCACAGACTGTATTTATTTAGGG - Intronic
1059535031 9:115072681-115072703 CCAAAGTCAGCATTGTTATGTGG - Intronic
1060009089 9:120027661-120027683 CCAAAGTCTGCAGTTCTATTTGG - Intergenic
1062563901 9:137155441-137155463 CGAAGGGCTGCATTTCTTTGTGG + Intronic
1202797278 9_KI270719v1_random:134334-134356 CCAAAGTGAGTCTTTATTTGGGG - Intergenic
1203700201 Un_GL000214v1:128780-128802 CCACATTCTGCGTTTTTTTGAGG - Intergenic
1203701115 Un_GL000214v1:134764-134786 CCACATTCTGCGTTTTTTTGGGG - Intergenic
1203480904 Un_GL000224v1:9640-9662 CCACATTCTGCGTTTTTTTGGGG - Intergenic
1203569546 Un_KI270744v1:118718-118740 CCACATTCTGCGTTTCTTTGGGG - Intergenic
1203570496 Un_KI270744v1:124999-125021 CCACATTCTGCGTTTTTTTGGGG - Intergenic
1186205289 X:7193799-7193821 CCAAAGTCTTCATCCATTTATGG - Intergenic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1190521762 X:51286249-51286271 TCACAGTCTGCATTCCTTTGCGG + Intergenic
1193386527 X:80879186-80879208 GCAAAGTTTGCATTTATGAGGGG - Intergenic
1193549900 X:82879108-82879130 CATAACTCTGCATTTATTTTGGG + Intergenic
1194361913 X:92962940-92962962 CATAAGTCTTCATTTCTTTGGGG - Intergenic
1195516372 X:105780758-105780780 CCATAGTCTGCATTGGTCTGTGG - Intergenic
1196016053 X:110941729-110941751 CCAAAGTCTGGTTTTATTCATGG + Intergenic
1197379519 X:125722315-125722337 CCAAAGTCTTAACTTATTTCAGG - Intergenic
1198570410 X:137949136-137949158 CGAATGTTTGCACTTATTTGTGG - Intergenic
1200670160 Y:6079156-6079178 CATAAGTCTTCATTTCTTTGGGG - Intergenic
1201578003 Y:15480824-15480846 CCAAAGTCTTCATCCATTTAGGG - Intergenic
1201948674 Y:19539921-19539943 ACAAATTAAGCATTTATTTGGGG + Intergenic