ID: 968386194

View in Genome Browser
Species Human (GRCh38)
Location 4:140517-140539
Sequence GGCCAAACCATACCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 1, 2: 10, 3: 22, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968386194_968386205 8 Left 968386194 4:140517-140539 CCCTCCTTTGGTATGGTTTGGCC 0: 1
1: 1
2: 10
3: 22
4: 91
Right 968386205 4:140548-140570 CTTTGGATTCTGGGGAGGTTTGG 0: 1
1: 19
2: 48
3: 47
4: 234
968386194_968386199 -2 Left 968386194 4:140517-140539 CCCTCCTTTGGTATGGTTTGGCC 0: 1
1: 1
2: 10
3: 22
4: 91
Right 968386199 4:140538-140560 CCCCAGTGCTCTTTGGATTCTGG 0: 1
1: 5
2: 33
3: 53
4: 199
968386194_968386204 3 Left 968386194 4:140517-140539 CCCTCCTTTGGTATGGTTTGGCC 0: 1
1: 1
2: 10
3: 22
4: 91
Right 968386204 4:140543-140565 GTGCTCTTTGGATTCTGGGGAGG 0: 1
1: 1
2: 40
3: 49
4: 209
968386194_968386201 -1 Left 968386194 4:140517-140539 CCCTCCTTTGGTATGGTTTGGCC 0: 1
1: 1
2: 10
3: 22
4: 91
Right 968386201 4:140539-140561 CCCAGTGCTCTTTGGATTCTGGG 0: 1
1: 6
2: 31
3: 58
4: 236
968386194_968386203 0 Left 968386194 4:140517-140539 CCCTCCTTTGGTATGGTTTGGCC 0: 1
1: 1
2: 10
3: 22
4: 91
Right 968386203 4:140540-140562 CCAGTGCTCTTTGGATTCTGGGG 0: 1
1: 6
2: 37
3: 60
4: 247
968386194_968386197 -9 Left 968386194 4:140517-140539 CCCTCCTTTGGTATGGTTTGGCC 0: 1
1: 1
2: 10
3: 22
4: 91
Right 968386197 4:140531-140553 GGTTTGGCCCCAGTGCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968386194 Original CRISPR GGCCAAACCATACCAAAGGA GGG (reversed) Intronic
912776670 1:112509874-112509896 AGCCCACCCATACCACAGGAAGG + Intronic
918190712 1:182171459-182171481 GGCCCAATCAGACTAAAGGAGGG - Intergenic
1063100484 10:2945678-2945700 AACCAAACCATATCAAAGGGGGG + Intergenic
1068107178 10:52633005-52633027 TCACAAACCATAGCAAAGGAAGG + Intergenic
1070647899 10:78214211-78214233 GGCCATCCCATTCCACAGGAGGG + Intergenic
1076654009 10:132009222-132009244 AGCCAAACAGTACCAAAGGAGGG - Intergenic
1077526249 11:3067548-3067570 GTCCAAACCAAACACAAGGATGG + Intergenic
1078373412 11:10772022-10772044 TGCCATACCATACCAATGTATGG - Intronic
1079237925 11:18702745-18702767 GGGTGAACCATGCCAAAGGAAGG + Exonic
1088103117 11:106176394-106176416 GGCCAAACAGTACCAAAGCAGGG - Intergenic
1090292482 11:125557682-125557704 GGCCAAACGTTAGCAAAGAATGG - Intergenic
1091390559 12:123735-123757 GGCCAAATGACACCAGAGGAGGG - Intronic
1092486406 12:8906197-8906219 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1092947758 12:13472529-13472551 GCCCAATCTATACCAATGGAGGG - Intergenic
1093501713 12:19820254-19820276 CGCCAAACCACCCCAAATGATGG - Intergenic
1094716025 12:33016193-33016215 AGCCAAACCATAACAACTGATGG - Intergenic
1095535409 12:43240230-43240252 AGCCAAACCATATCAAATGGTGG + Intergenic
1099178495 12:79451367-79451389 GGCCAAACCCTACCAAAGAGAGG + Exonic
1099509416 12:83515420-83515442 TACCAAACCACACCAAATGAAGG - Intergenic
1101991184 12:109486740-109486762 GTCCAACACACACCAAAGGAGGG - Intronic
1102863555 12:116356866-116356888 GGCCACACAATCCCAAATGAAGG + Intergenic
1104258344 12:127160183-127160205 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1105466105 13:20642122-20642144 GGCCAAAGCTTACCAAAATAAGG - Intronic
1105625270 13:22106538-22106560 GGCGACACCCAACCAAAGGAGGG + Intergenic
1107242273 13:38250770-38250792 GGTAATACAATACCAAAGGAAGG + Intergenic
1110821507 13:79922751-79922773 GTCCAAACCATTGAAAAGGAGGG - Intergenic
1114919391 14:27307515-27307537 GGCCAAACAGTATCAAAGGAGGG - Intergenic
1116336772 14:43666441-43666463 AGCCAAAGCATATCATAGGATGG - Intergenic
1116577008 14:46587667-46587689 GGCCAAATAGTACCAAAGGAGGG + Intergenic
1116811022 14:49540420-49540442 GACCTAACCAACCCAAAGGAAGG + Intergenic
1118530396 14:66698719-66698741 CCCCAACACATACCAAAGGATGG - Intronic
1120232501 14:81855606-81855628 GGCCAAATAGTACCAAAGGAAGG + Intergenic
1121268549 14:92622004-92622026 AGCCAAACAGTACCAAAGGAGGG + Intronic
1121751573 14:96362702-96362724 GTCCAAACAATTCCCAAGGAGGG + Intronic
1121853632 14:97246549-97246571 GGCCAAACCAAACCCTGGGATGG - Intergenic
1123061242 14:105595553-105595575 GTCCAAACAACACCAGAGGAGGG - Intergenic
1131047565 15:89325824-89325846 GGCTAAAGCATCCCAGAGGAGGG - Intronic
1134366051 16:13580233-13580255 GCCCAAACCATTCCAGAGCAAGG - Intergenic
1137801796 16:51268281-51268303 AGCCAAACCATATCAAAGCCAGG + Intergenic
1145746184 17:27321606-27321628 GGGCAAATGATACCAAAGGATGG + Intergenic
1150096124 17:62377331-62377353 GGCCAAACCAAACCAAACATAGG + Intronic
1155438493 18:25836919-25836941 AGCCATTCCACACCAAAGGAGGG + Intergenic
1156754107 18:40499717-40499739 GGCTAATCCATACTAAAGTATGG - Intergenic
1157013534 18:43681749-43681771 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1157568818 18:48698763-48698785 AACCAAACCAAACCATAGGAAGG - Intronic
1157896571 18:51474677-51474699 GGCCAAAACACACAAAAGAAAGG - Intergenic
1158671347 18:59476852-59476874 GGACAAACCATACCATATGTTGG - Intronic
1164197332 19:22981485-22981507 TTCCAAACAATACAAAAGGAGGG + Intronic
1164460984 19:28447076-28447098 GGCCAAACAGTACCAAAGCAAGG - Intergenic
932692967 2:73929123-73929145 GGCAAGACCACACCAAAGGAGGG - Intronic
936500345 2:113061777-113061799 GTCCAAACAATTCCAAAGGGGGG + Intronic
942434950 2:175961162-175961184 TTCCAAACAATACAAAAGGAGGG + Intronic
943084698 2:183297900-183297922 TTCCAAACCATAGAAAAGGAGGG - Intergenic
944254956 2:197616198-197616220 GCCCTAACAAGACCAAAGGAAGG - Intronic
946864861 2:224033797-224033819 GGCAGAACCATGCCAAAGGGAGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1172416519 20:34773330-34773352 GGCCAAAACTTAAAAAAGGAAGG + Intronic
1175197750 20:57256469-57256491 GGCCAAACCTGACCCAAGGTTGG - Intronic
1181460448 22:23083115-23083137 CTGGAAACCATACCAAAGGAGGG + Intronic
949754334 3:7392089-7392111 GTTCAAACCACACCAAAGGAGGG - Intronic
950615668 3:14156021-14156043 GTCAAAAACATACAAAAGGAAGG - Intronic
951841851 3:27043313-27043335 GACCAAACCATACCAAAGGAGGG + Intergenic
958169591 3:89922115-89922137 GGCCAAACAACACCACAGAAGGG + Intergenic
959150255 3:102599456-102599478 AGCCAAACCATACCAAAGTCTGG + Intergenic
959339307 3:105108898-105108920 AGACAAAGCATGCCAAAGGAAGG - Intergenic
961852787 3:129838451-129838473 TGCCAAACAATACCAAAAAAGGG + Intronic
962878526 3:139554328-139554350 GGCCAAACCACACCACTGGAGGG - Intergenic
963219897 3:142797444-142797466 GAGCAAATCAGACCAAAGGAGGG + Intronic
963576006 3:147060961-147060983 GGCAAAACAGTACCAAAGGAGGG - Intergenic
963923044 3:150924313-150924335 TGACAAACTATACCAGAGGAGGG + Intronic
968386194 4:140517-140539 GGCCAAACCATACCAAAGGAGGG - Intronic
969292971 4:6252433-6252455 GGCCATACCATCCCAGAGCATGG + Intergenic
969589081 4:8110995-8111017 AGCCAAACCATGCAAAAGCAGGG + Intronic
970012268 4:11471976-11471998 GGACAATCCATAGCAAAGCATGG + Intergenic
970666173 4:18339778-18339800 TTCCAAACAATTCCAAAGGAGGG - Intergenic
974190212 4:58494654-58494676 GGCCAAACAGTACCAAAGAAGGG + Intergenic
974733862 4:65902536-65902558 GAACAAACCAAACCCAAGGATGG - Intergenic
976223688 4:82778559-82778581 GGCCAGACCATCCCCAGGGAGGG + Intronic
978731326 4:112030331-112030353 GGCAAAGCCATACTAATGGATGG + Intergenic
980302630 4:131014014-131014036 GGCCAAACAGTACCAAAGGAGGG + Intergenic
987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG + Intergenic
991523465 5:67528705-67528727 GGCCAAACTCTTCCAAAGAATGG - Intergenic
994150115 5:96437858-96437880 AGCCAATCCAAACCAAAGAATGG - Intergenic
996120333 5:119664950-119664972 GGCCAAACTGTACAAAAGGAGGG + Intergenic
1001843437 5:174900983-174901005 GACCAAGCTATACCATAGGAGGG + Intergenic
1006416269 6:33905915-33905937 GTCCAGACAATACAAAAGGAGGG + Intergenic
1010493176 6:76499128-76499150 GGAAAAACTAGACCAAAGGAGGG + Intergenic
1017185110 6:151592714-151592736 AGCCAAACCATATCAATGGGTGG + Intronic
1018360627 6:163063720-163063742 AGTGAAACCAAACCAAAGGACGG + Intronic
1020286083 7:6681927-6681949 GGCGAAACCAAACCAAAAAACGG - Intergenic
1021298098 7:18934664-18934686 TGGCAAACCATACCAAATGTTGG + Intronic
1021503330 7:21353929-21353951 AACCAAACCAAACCAAAGAATGG - Intergenic
1024294959 7:47834246-47834268 GGCCAGACCATAGCCAAGGGAGG + Intronic
1024329079 7:48138890-48138912 GGCCAAACCAAGCCAAAGGAGGG + Intergenic
1024599396 7:50966208-50966230 GGCCAAACTGTACCAAAGGAGGG - Intergenic
1027590643 7:80114535-80114557 GGCCAAAATAAATCAAAGGATGG + Intergenic
1027707282 7:81550104-81550126 TGCCAAACAGTACCAAAGGGGGG - Intergenic
1027909430 7:84230126-84230148 GGCCATATCATAAAAAAGGAAGG - Intronic
1029001104 7:97155404-97155426 GGCCAAGCTAAATCAAAGGAAGG - Intronic
1029892061 7:103940876-103940898 GGCAAAAGCATAACAAAGGAAGG - Intronic
1029956889 7:104649591-104649613 GGCCAAACCATAACATTTGATGG + Intronic
1030197824 7:106869373-106869395 GGCCAAAACATACCAATTGTTGG + Exonic
1032429855 7:131851768-131851790 GCCCAAACAAAACGAAAGGAGGG + Intergenic
1032728016 7:134610081-134610103 GTAAAAACCATACCAAAGGCTGG + Intergenic
1033723150 7:144083838-144083860 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1037075725 8:14714993-14715015 GGCAAAACCAGACCATTGGAAGG - Intronic
1042414653 8:68505186-68505208 AGACAAACCATAACAAATGATGG - Intronic
1045972884 8:108099698-108099720 GGCCAAACAAGACCCTAGGAAGG + Intergenic
1046486789 8:114897156-114897178 GGCCAAACAATATCAAAGGAGGG - Intergenic
1053529702 9:38868175-38868197 AGCCAAACAATGCCAAAGGCTGG + Intergenic
1054201927 9:62092602-62092624 AGCCAAACAATGCCAAAGGCTGG + Intergenic
1054636430 9:67495757-67495779 AGCCAAACAATGCCAAAGGCTGG - Intergenic
1056656755 9:88515905-88515927 AGGGAAACCATACCAGAGGAGGG + Intergenic
1061564575 9:131429601-131429623 AGCAAAACCAAATCAAAGGAGGG - Intronic
1187206833 X:17189810-17189832 GGCTATGCCATAGCAAAGGAGGG - Intergenic
1187439752 X:19307417-19307439 GGCCAAACCCAACCAGAAGAGGG + Intergenic
1187989866 X:24858672-24858694 GGCCAAAACATTTCAAAAGATGG - Intronic
1193491719 X:82158229-82158251 CTCCAAACCAGACCAAAGAAAGG - Intergenic
1194350854 X:92824106-92824128 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1196901130 X:120384522-120384544 GGCCAAACCCAACCAAAAGCTGG + Intergenic
1196968358 X:121083020-121083042 GGCCAAACTGTACCAGAGGAGGG + Intergenic
1196974238 X:121141302-121141324 GGCCAAACTGTACAAAAGGAGGG + Intergenic
1197243401 X:124144516-124144538 GGCCAAACAGTACCAAATGAGGG + Intronic
1199861638 X:151806183-151806205 GGCAAATCCATAGCAAAGGCCGG + Intergenic
1200659179 Y:5940789-5940811 GGCCAAACAGTACCAAAGGAGGG + Intergenic