ID: 968386839

View in Genome Browser
Species Human (GRCh38)
Location 4:148107-148129
Sequence CTGCCCGCCCAGAAATCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968386839_968386842 4 Left 968386839 4:148107-148129 CCTTCAGATTTCTGGGCGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 968386842 4:148134-148156 GCTCCCAGACTCTAGCGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 53
968386839_968386846 10 Left 968386839 4:148107-148129 CCTTCAGATTTCTGGGCGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 968386846 4:148140-148162 AGACTCTAGCGGACAGGGAATGG 0: 1
1: 0
2: 1
3: 9
4: 133
968386839_968386847 16 Left 968386839 4:148107-148129 CCTTCAGATTTCTGGGCGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 968386847 4:148146-148168 TAGCGGACAGGGAATGGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 87
968386839_968386843 5 Left 968386839 4:148107-148129 CCTTCAGATTTCTGGGCGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 968386843 4:148135-148157 CTCCCAGACTCTAGCGGACAGGG No data
968386839_968386848 23 Left 968386839 4:148107-148129 CCTTCAGATTTCTGGGCGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 968386848 4:148153-148175 CAGGGAATGGCGCTGGTTACAGG No data
968386839_968386849 24 Left 968386839 4:148107-148129 CCTTCAGATTTCTGGGCGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 968386849 4:148154-148176 AGGGAATGGCGCTGGTTACAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
968386839_968386841 -1 Left 968386839 4:148107-148129 CCTTCAGATTTCTGGGCGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 968386841 4:148129-148151 GGACTGCTCCCAGACTCTAGCGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968386839 Original CRISPR CTGCCCGCCCAGAAATCTGA AGG (reversed) Intronic
901692046 1:10980142-10980164 CTGCCCACCCAGGAATCGAATGG - Intronic
905801688 1:40848255-40848277 CCGCCTGCCCAGAACTCGGATGG + Intergenic
906646368 1:47478225-47478247 CGGCTCGCCCAGGAATGTGAGGG - Intergenic
907942829 1:59105770-59105792 CTCACTGCTCAGAAATCTGAAGG - Intergenic
918170167 1:181988806-181988828 CTTCAAGCCCAGAAGTCTGAGGG - Intergenic
922361670 1:224828422-224828444 ACGCCCGCACAGAAACCTGATGG + Intergenic
1065508526 10:26454401-26454423 CTGGCTGCTCAGGAATCTGATGG + Intronic
1065882038 10:30045211-30045233 CTGCCCACACAGAATTCTAAAGG + Intronic
1066312251 10:34208748-34208770 CTGGCTGCCTAGGAATCTGATGG - Intronic
1070768857 10:79070778-79070800 CTGCCTACCCAGGAAGCTGACGG - Intronic
1070992212 10:80742360-80742382 CTGCCTGTCAAGAAATCAGATGG + Intergenic
1074931307 10:118128974-118128996 CTACCAGCCCTGAAATCTGATGG + Intergenic
1075873275 10:125786601-125786623 CTGATCTCCCAGGAATCTGAGGG - Intronic
1075873514 10:125788309-125788331 CTGATCTCCCAGGAATCTGAGGG - Intronic
1077986363 11:7355283-7355305 CTGGCCTCCCACAAAGCTGAGGG - Intronic
1079085032 11:17439332-17439354 TTGCCTGCCCAGAAGTCTGATGG + Intronic
1080115170 11:28614129-28614151 CTGCCAGCCCAGAAGGGTGAGGG + Intergenic
1089678355 11:120105582-120105604 CTGCCCCCCAGGAAGTCTGATGG - Intergenic
1091252601 11:134156173-134156195 CTGCCCTCCCAGAAGTCTCCGGG + Intronic
1094131512 12:27080437-27080459 CTGCCACCACAGGAATCTGATGG + Intergenic
1105229797 13:18481523-18481545 CAGCCCGCCCAGACATTAGATGG + Intergenic
1114334054 14:21669549-21669571 AGGGCTGCCCAGAAATCTGAAGG + Intergenic
1120859187 14:89239358-89239380 CCCCCCTCCAAGAAATCTGAGGG - Intronic
1122371484 14:101231098-101231120 CTGCCCCCCGTGAAAGCTGAGGG - Intergenic
1123116933 14:105899111-105899133 CTGCCCACCCAGAAAACTCTGGG - Intergenic
1125689957 15:41587868-41587890 CTGCCAGTCAAGAAATCAGATGG + Intergenic
1128305898 15:66598759-66598781 CTCCCCTCCCAGCACTCTGAGGG - Intronic
1131211405 15:90500120-90500142 CTGCCAGCCCAGAAGGATGAAGG + Exonic
1131826042 15:96323028-96323050 CCGCCCGCCCACACCTCTGAGGG + Intergenic
1133008625 16:2898049-2898071 CTGCACGGCCAGCAAACTGAAGG - Intronic
1133833110 16:9342443-9342465 CTGGCAGCCCTGAAAGCTGAGGG - Intergenic
1136140020 16:28282412-28282434 ATGGCCGCCCTGAGATCTGAGGG - Intergenic
1140186464 16:72777235-72777257 AAGCCAGCCCAGAAATATGAGGG - Intergenic
1141760688 16:86026626-86026648 CTGCCCACCCAGCAACCTGCTGG - Intergenic
1143617516 17:8062415-8062437 CTACCCACCCAAAAACCTGAAGG + Intergenic
1143944585 17:10579131-10579153 ATGCCCAAACAGAAATCTGAGGG + Intergenic
1144758340 17:17693625-17693647 CTGCCTGCCCAGCCAGCTGAAGG - Intronic
1145415698 17:22712009-22712031 CTGCCTAACCATAAATCTGACGG + Intergenic
1145827206 17:27885989-27886011 CTCACCACCCAGAAATCAGAGGG + Intronic
1148162155 17:45456529-45456551 CTGCCCCTCAAGAAACCTGATGG + Intronic
1148563336 17:48618791-48618813 CTGCTCTCCCAGAAAACTGGTGG - Intronic
1153691633 18:7600365-7600387 CTGCGCAGCCAGAAATCTGGAGG + Intronic
1159445947 18:68541993-68542015 ATGCCCGGCCCGAGATCTGATGG - Intergenic
1162268212 19:9593631-9593653 CTGCCAGTCAAGAAATCAGATGG - Intergenic
1165443490 19:35844138-35844160 CTGCACTGCCAGAACTCTGAGGG - Exonic
1167748926 19:51368378-51368400 CCGCCCGCCCAGATGTCAGAGGG - Intronic
927250628 2:20992235-20992257 CTGGCCTCCCAGAGAGCTGAGGG + Intergenic
927725371 2:25418179-25418201 CCGACAACCCAGAAATCTGATGG - Intronic
929432086 2:41895766-41895788 CTGCCTGCCAGGACATCTGATGG + Intergenic
930524662 2:52512781-52512803 CTCCCCACCCAGAACACTGAGGG + Intergenic
934504328 2:94879391-94879413 CTGCTGGGCCAGAACTCTGAGGG + Intergenic
934916649 2:98305676-98305698 CTGTCCAGCCAGAAATCTGGTGG + Intronic
937208270 2:120250951-120250973 CTGCCTGCCTAGAACTCGGAGGG - Intronic
937225284 2:120365314-120365336 CTGGCCGCACAGAAGTCTCAGGG - Intergenic
937856216 2:126673647-126673669 CTGCCTGCCCAGGAATCTGTGGG - Intronic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
948149925 2:235737050-235737072 CTGCCAGCCCAGACTTCTCAAGG + Intronic
948721212 2:239901514-239901536 CTGCCCCCCAAGAGCTCTGATGG + Intronic
1172409558 20:34711166-34711188 CTGCAGGCCCTGAAATCTGAAGG + Exonic
1173081306 20:39870531-39870553 CTGGACACCCAGAAACCTGAAGG - Intergenic
1176773788 21:13109882-13109904 CAGCCCGCCCAGACATTAGATGG + Intergenic
1177389564 21:20450608-20450630 CTGCCGGCCCAGGACTGTGATGG - Intergenic
1178915840 21:36705205-36705227 CTGCCCGCGCAGAAAGCTCCAGG + Intronic
1179045749 21:37843807-37843829 CTGCTCTCCCAGAAATCTTAAGG + Intronic
1179318902 21:40271140-40271162 CTGACAGTACAGAAATCTGATGG + Intronic
1179654970 21:42839282-42839304 GTGCCCTCCCCCAAATCTGATGG + Intergenic
1181756531 22:25028549-25028571 CTGCCCACCCAGAAGCCTGCGGG + Exonic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183928920 22:41225096-41225118 CCCCCCGCTCAGAAATCTGGAGG - Intronic
1184674755 22:46035750-46035772 CGGCCCGCTCAGAAAGCTCAGGG - Intergenic
952821802 3:37492327-37492349 CTGCCCCACCAGAGGTCTGAGGG - Intronic
956979420 3:74617936-74617958 CTTCCGGCCCAGAAATTGGATGG - Intergenic
959693945 3:109229843-109229865 CTGTCACCCAAGAAATCTGAGGG + Intergenic
960747709 3:120908289-120908311 CTGCCAGCCCGGGAAGCTGAGGG - Exonic
961582499 3:127894010-127894032 CTGCCAGTCAAGAAATCAGACGG + Intergenic
964768173 3:160198213-160198235 CTGTCTGCCCAGCATTCTGAGGG - Intergenic
965322921 3:167269703-167269725 CTGCCCGTCAAGAAATCAGATGG + Intronic
968386839 4:148107-148129 CTGCCCGCCCAGAAATCTGAAGG - Intronic
968395987 4:239101-239123 CTGCCCACCCAGGAATCTGGAGG - Intergenic
968408081 4:359551-359573 CTGCCCACCTAGAAATCTGGAGG - Intronic
968414978 4:423981-424003 CTGCCCACCCAGGAATCTGGAGG - Intergenic
968418064 4:457914-457936 CTGCCAACCCAGAAATCTGGAGG + Intronic
968705934 4:2077506-2077528 CTGCCCTTCCAGAAGTCAGAGGG + Intronic
969468486 4:7371797-7371819 CTGCACGCCCAGGCCTCTGACGG + Intronic
971476769 4:27080069-27080091 CTTCCCTCCTAGAACTCTGAAGG - Intergenic
975609135 4:76186515-76186537 CTGCCCGCTCAGGTAACTGAAGG + Intronic
976903826 4:90211246-90211268 CTGCAAGCCCAGAAATTTGTGGG + Intronic
978179537 4:105776214-105776236 CTGCCAGCACAGCAGTCTGAAGG - Intronic
978310818 4:107383223-107383245 CTGCCTGTCAAGAAATCAGATGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979975962 4:127196727-127196749 CTGCCAGTCCAAAGATCTGAGGG - Intergenic
985635412 5:1033377-1033399 CTCCCCGCTGAGAAAGCTGAGGG + Exonic
995301913 5:110594570-110594592 CTGCCAGCACAGCAGTCTGAAGG + Intronic
1000215016 5:159146970-159146992 CTGCCCTCACAGAACTCTCATGG - Intergenic
1007091133 6:39185577-39185599 CTGGGCTCCCAGGAATCTGAAGG + Intergenic
1007681416 6:43636131-43636153 CTCCCCGCTCAGAAAGCTGCGGG - Intronic
1009884028 6:69603153-69603175 CTGCTCTCCCAGAAATCAGCTGG - Intergenic
1010379609 6:75209098-75209120 CTGTCGGACAAGAAATCTGAGGG - Intergenic
1013635415 6:112024705-112024727 CTCACCTCCCAGATATCTGATGG + Intergenic
1015626152 6:135182263-135182285 CTGTCCGGCCAAAAATGTGAAGG - Intronic
1017204053 6:151786082-151786104 CTGCCCGCCCCAACATCTGAGGG + Intronic
1018247069 6:161833611-161833633 CTGCCCACCCGGACATCCGAGGG - Intronic
1018817242 6:167342874-167342896 CTGCCCACCCAGGAACCTGCTGG - Intronic
1019917647 7:4143965-4143987 CTGGCCGCCCCGCACTCTGACGG - Intronic
1020582574 7:10023076-10023098 CTGCCGGCCCAGCTTTCTGATGG + Intergenic
1020745081 7:12070046-12070068 CTGCCTGTCAAGAAATCAGATGG + Intergenic
1024366277 7:48524123-48524145 CTGACTGCCCAGAAGTCCGAAGG + Intronic
1025711228 7:63911789-63911811 CTACCCACCCAGAAACCTGGAGG - Intergenic
1025933044 7:66011700-66011722 CACCCAGGCCAGAAATCTGAGGG + Intergenic
1027146682 7:75700422-75700444 CTGCTCACCCAGAACCCTGATGG + Intronic
1027864579 7:83629665-83629687 CTGCCAGCACAGCAGTCTGAAGG - Intronic
1028406614 7:90482102-90482124 CTGCCCTCCCAGAAGTTGGAAGG + Intronic
1030517519 7:110556951-110556973 GAGCCCTCCCAGAAACCTGAAGG - Intergenic
1033560061 7:142522368-142522390 CAGGCTGCTCAGAAATCTGAGGG - Intergenic
1034325790 7:150230751-150230773 CTGCATGCCCACAAATTTGATGG - Intergenic
1034767416 7:153738508-153738530 CTGCATGCCCACAAATTTGATGG + Intergenic
1040067746 8:43161912-43161934 CTGCCAGCCCAGGCATCTGGTGG + Intronic
1048991236 8:139761445-139761467 TTTCCCGCCCAGAACTCTAAGGG - Intronic
1049216243 8:141409661-141409683 CTGCTCTCCCAGGCATCTGAAGG - Intronic
1049771368 8:144383555-144383577 CTGCCAGCCTAGAAGCCTGAGGG - Intronic
1051932763 9:22406511-22406533 CTACACTCCCAGAAAACTGAGGG + Intergenic
1052225331 9:26078162-26078184 CTCCCCGCCCAGAGTTCTGTAGG + Intergenic
1052302829 9:26973285-26973307 CTGCCTGTCAAGAAATCAGATGG - Intronic
1053391554 9:37739972-37739994 CTGCCAGACGAGAAAACTGAGGG - Intronic
1056543811 9:87596423-87596445 CTGCCCAGCCAGAACACTGAAGG + Intronic
1057481925 9:95451430-95451452 GTTCCCGCCCAGAAATATCAGGG - Intronic
1062579898 9:137224847-137224869 CTGCAGGCCCGGGAATCTGAGGG + Exonic
1187448811 X:19379341-19379363 CTGCTCTCCCAGAAATAGGAAGG + Intronic
1189555102 X:42135070-42135092 CTGCCTTCCCAGAAATATGTTGG - Intergenic
1192682005 X:73262295-73262317 CTGCCTGTCAAGAAATCAGATGG - Intergenic
1193726159 X:85041669-85041691 CTGCCCACCCAGAAAACTCCAGG + Intronic
1195065386 X:101234476-101234498 CTGACCCCCCAGGAATCTGGAGG - Intronic
1201401307 Y:13607228-13607250 CTGCCCGCACAGCAGTCTGGAGG - Intergenic
1201972653 Y:19814251-19814273 CTGCCTGTCAAGAAATCAGATGG - Intergenic