ID: 968387964

View in Genome Browser
Species Human (GRCh38)
Location 4:160983-161005
Sequence CCAAAAGGACATGAGAAACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968387956_968387964 30 Left 968387956 4:160930-160952 CCCAAAACCTTTGGACAGTGCAG 0: 1
1: 1
2: 4
3: 29
4: 161
Right 968387964 4:160983-161005 CCAAAAGGACATGAGAAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
968387957_968387964 29 Left 968387957 4:160931-160953 CCAAAACCTTTGGACAGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 118
Right 968387964 4:160983-161005 CCAAAAGGACATGAGAAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
968387960_968387964 23 Left 968387960 4:160937-160959 CCTTTGGACAGTGCAGGGCATAG 0: 1
1: 1
2: 1
3: 28
4: 233
Right 968387964 4:160983-161005 CCAAAAGGACATGAGAAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
968387962_968387964 -10 Left 968387962 4:160970-160992 CCACAAACTTATACCAAAAGGAC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 968387964 4:160983-161005 CCAAAAGGACATGAGAAACGTGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968387964 Original CRISPR CCAAAAGGACATGAGAAACG TGG Exonic
906552121 1:46673606-46673628 CTAACAGCAAATGAGAAACGAGG - Intronic
907302517 1:53497320-53497342 TGAAGAGGACATGAGAAACCAGG - Intergenic
911973723 1:104466110-104466132 CCAAAAGGACAAGGGAAGGGGGG - Intergenic
912310071 1:108611364-108611386 CCACATGGAAATGAGAAACAGGG + Intronic
913535207 1:119765453-119765475 CTAAAAGGATATGGGAAAGGAGG - Intronic
918378657 1:183933560-183933582 CCAAAAGGAAATGAGAAGTTTGG - Intronic
918428725 1:184436681-184436703 CTAAAGGGACAAGAGAAAGGGGG - Intronic
919540512 1:198839505-198839527 CCAAAGGGAGAGGAGAAATGAGG + Intergenic
919763214 1:201111237-201111259 CTGGAAGGACAAGAGAAACGTGG - Intronic
920697352 1:208191323-208191345 AGAAAAGGAGATGAGAAAAGTGG - Intronic
921367722 1:214389575-214389597 CCTAAAGGACAGGGGAAAGGGGG + Intronic
922629088 1:227085687-227085709 CCAAAAGGAAATGAGATCCAGGG + Intronic
923468882 1:234272779-234272801 CCAAGAGGACATGTGGAACCAGG - Intronic
1065228887 10:23576409-23576431 CAAAAAGGACATGAGATAATTGG - Intergenic
1066338205 10:34502095-34502117 CCTGTAGGACATGAGAAATGAGG + Intronic
1066616517 10:37300462-37300484 CCAAATAGACAAGAGAAAGGGGG - Intronic
1069860031 10:71464866-71464888 TCAGAAGGACAGGAGAAAGGGGG - Intronic
1070377203 10:75844272-75844294 GCAAAAGGAAAAGAGAAAGGGGG - Intronic
1071375553 10:84998735-84998757 CAAAAAGTTCTTGAGAAACGGGG + Intergenic
1075600895 10:123768480-123768502 CCAATAGGACATGGGCAGCGAGG - Intronic
1081104564 11:39049025-39049047 CCAAAAGAACATGGGAACCTAGG + Intergenic
1082695530 11:56359512-56359534 ACAAAAAGACATGAGAAAGAAGG + Intergenic
1083588550 11:63878258-63878280 CCAAATGGAGATGAGGAATGAGG - Intronic
1083708047 11:64530099-64530121 CAAAAGGGAAATGAGAAAAGTGG - Intergenic
1083985691 11:66213707-66213729 CCAAAAGGGAATTAGAAACATGG - Intronic
1086070071 11:82790280-82790302 GCAAGAGGACATGAGACACTAGG + Intergenic
1086324971 11:85689147-85689169 GGAAAAGGACAAGAGAAATGTGG - Intergenic
1089137796 11:116263519-116263541 CCATAAGGGCAAGAGAAAAGGGG - Intergenic
1093811029 12:23492306-23492328 CAAAAAGGAGATGACAAACATGG - Intergenic
1097822771 12:64144690-64144712 CCAAAAGCTCAGGAGAAATGGGG - Exonic
1098995704 12:77117116-77117138 CCAAATGGCCAGGAGAAACATGG - Intergenic
1099037331 12:77605040-77605062 CCAAGGGGACAGGAGAAAAGGGG + Intergenic
1100834700 12:98555210-98555232 CCAAAAGAAAATGGGAAAAGAGG + Intergenic
1101591535 12:106129510-106129532 TCACAAGGACACGAGACACGGGG + Intronic
1105381531 13:19891905-19891927 TCAATAGGATATGAGAAACCTGG - Intergenic
1105934433 13:25086071-25086093 ACCAAGGAACATGAGAAACGTGG - Intergenic
1106137911 13:26988271-26988293 CCCAAAGGCCATCAGAAATGGGG - Intergenic
1110618810 13:77571911-77571933 GCTAAAGGAAATGAGAAAAGAGG + Intronic
1112616803 13:101014805-101014827 CCCAAGGGACATGAAAAATGGGG - Intergenic
1116053661 14:39836799-39836821 TCAAAATGACATGACAAAAGTGG - Intergenic
1125609133 15:40959007-40959029 CCAAGATGTCAAGAGAAACGAGG + Intergenic
1125737959 15:41941771-41941793 CCAAAATGCCAAGAGAAAGGAGG + Intronic
1126316494 15:47375431-47375453 CCAGAGGTACATGAGAAAGGAGG - Intronic
1126772106 15:52068432-52068454 GCAATAGGAAATGAGAAACAAGG - Intergenic
1126957547 15:53951092-53951114 GCAAAAGGACCTTAGAAATGAGG - Intergenic
1127850259 15:62905682-62905704 CCAAAAGCATTTGAGAAACTGGG + Intergenic
1129929853 15:79401734-79401756 ACAAATGGAAAAGAGAAACGAGG + Intronic
1132061255 15:98694034-98694056 CCAAATGGTCACCAGAAACGAGG - Intronic
1133086812 16:3371068-3371090 ACAAAAGGACAAGAGAAGCAGGG - Exonic
1138218008 16:55222542-55222564 CCAAATGGAGATGGGAAAGGGGG - Intergenic
1138387558 16:56646425-56646447 ACACAAGGACATGAAAAACCTGG - Intronic
1138811687 16:60158343-60158365 CAAAAAGGATATGACAAAGGAGG + Intergenic
1139580099 16:67867984-67868006 CCAAAAGGTCATCAGAAATGTGG - Intronic
1141641183 16:85342536-85342558 CCAAAAGGATATGAGAGTGGGGG - Intergenic
1141726014 16:85788897-85788919 CGAAAAGCACACGAGAGACGGGG + Intronic
1141995261 16:87633021-87633043 GTAAAAGGACAGGAGAAGCGTGG - Intronic
1142674263 17:1503845-1503867 CCAAGATGTAATGAGAAACGAGG - Intronic
1144375187 17:14632843-14632865 CCAAAATGGCATGAGATATGAGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1146712302 17:35052950-35052972 CCAAAAGCACAACAGAAACAAGG + Intronic
1149984766 17:61339067-61339089 CCAAAAGAACATGAGAAAATGGG - Intronic
1150819131 17:68420867-68420889 CCAAAATGACCAGAGAAACTGGG - Exonic
1151948704 17:77334517-77334539 CCAAAAGGAAAGGAGCAATGTGG - Intronic
1152272428 17:79332475-79332497 ACAAAAAGAGATGAGAGACGGGG + Intronic
1156682753 18:39610816-39610838 TCAAAAGAAAATGAGAAATGAGG - Intergenic
1158371142 18:56805842-56805864 CCCAAAGGCAATGAGAAACAGGG - Intronic
1160608029 18:80066776-80066798 CCCAAAGGACATGAGAGCTGAGG + Intronic
1165908428 19:39208334-39208356 ACAAAAGGAAATGAGAAAGAAGG - Intergenic
927732593 2:25487748-25487770 CCAAAAATACATGAGAAACTGGG + Intronic
929013876 2:37474815-37474837 CTGAAAGGACATAAGAAACTGGG - Intergenic
931472128 2:62548888-62548910 CCAAATGAACATGAGAAGAGAGG - Intergenic
931969395 2:67568915-67568937 CCAAAAGGAGTTGAGTAAAGAGG - Intergenic
932707913 2:74040935-74040957 CCAGAAGGGCATGAGAATTGAGG + Intronic
933241715 2:79929116-79929138 CCAGAAAGACATTAAAAACGTGG - Intronic
936162101 2:110091660-110091682 CATCAAGGAGATGAGAAACGAGG + Exonic
936182561 2:110279694-110279716 CATCAAGGAGATGAGAAACGAGG - Intergenic
938321370 2:130367863-130367885 CCAGAAGGAAAGGAGAAAGGGGG - Intronic
940721257 2:157284919-157284941 CCAATAGGACAAGAGAGATGAGG + Intronic
941530301 2:166661912-166661934 CCAAAAGGAAAAGAGTGACGGGG - Intergenic
941918383 2:170827032-170827054 CCCAAAGGACATGAGAAGGGGGG - Intronic
942309584 2:174642821-174642843 GGAAAAGGAAATAAGAAACGTGG - Intronic
945829362 2:214764386-214764408 CCAAAAGGACAGGATAACCCAGG + Intronic
946279011 2:218652616-218652638 CCAAAAGAAAATGACAAACTAGG + Intronic
946549398 2:220784238-220784260 GCAAAAAGAAATGAGAAACTGGG + Intergenic
947959782 2:234226341-234226363 TAAAAAGGACTTGAGAAATGGGG + Intergenic
1169866662 20:10208157-10208179 CCAAAAGGAGATGAGAGAAATGG - Intergenic
1174738859 20:52992497-52992519 CCAAAGGGACAGGAGACAAGGGG - Intronic
1175185616 20:57178136-57178158 CCAAAAGGAAGTGAGATAGGAGG + Intronic
1175615755 20:60397045-60397067 CCAGAAGGAGATGAGACACATGG + Intergenic
1180923180 22:19533084-19533106 CCAAAAGGAGAGGAGAAAGGGGG + Intergenic
1182296506 22:29313576-29313598 CCGAATGGAGATGAGAGACGCGG + Intronic
1185056243 22:48579847-48579869 CCAAAGGGACATGAGAAAGCCGG + Intronic
1185314073 22:50171230-50171252 CCCAAATGTCATGAGACACGGGG + Intronic
950225757 3:11233197-11233219 CCAGAAGGAGATGAGAAAGAGGG - Intronic
950488067 3:13284643-13284665 CCATAAGGTCATGAGAAGCCTGG - Intergenic
953500622 3:43430049-43430071 CCAATAGAACATGCGAAATGTGG + Intronic
953551594 3:43907623-43907645 TCCAAAGGACATGATAAAGGAGG + Intergenic
954011764 3:47646341-47646363 ACAAAATGACATGAGATACATGG - Intronic
954472812 3:50713095-50713117 ACAAAGGGAGATGAGAAAGGAGG + Intronic
954493377 3:50929505-50929527 TCAAAATGACATGAGAAGCAAGG - Intronic
955816872 3:62853164-62853186 CCAGAAAGACATGATAAAAGTGG - Intronic
955961726 3:64347553-64347575 ACAAAAGGAAAAGAAAAACGAGG + Intronic
956380433 3:68659199-68659221 ACGAAAGGACAAGAGAAATGGGG - Intergenic
961575133 3:127829573-127829595 CCAAAAGGAGAAGAGAAAAGAGG - Intergenic
962994523 3:140612180-140612202 CACATAGGACATGAGAAAGGGGG + Intergenic
965720664 3:171657772-171657794 CCAAAAGGACAAGCGATACAAGG + Intronic
965722797 3:171680204-171680226 ACAAAAAGACAGGAGAAAGGGGG - Intronic
968387964 4:160983-161005 CCAAAAGGACATGAGAAACGTGG + Exonic
972194572 4:36638083-36638105 CCAAAAGGATTTGAGCAATGTGG - Intergenic
976023534 4:80660941-80660963 CCAAAAAGACATGGGAAATGGGG + Intronic
976288308 4:83391371-83391393 CTAAAAGGACAGGAGAATTGGGG - Intergenic
976868484 4:89761172-89761194 CAAAATGGAAATGAGAAACTGGG - Intronic
977967787 4:103174218-103174240 CCCAAAGGACATTATAAACCAGG + Intronic
979484601 4:121256106-121256128 CTAAAGGGACATGAGAGATGTGG - Intergenic
982766876 4:159358845-159358867 CCAGAAGGACATGGGAAGCCAGG - Exonic
992364235 5:76075443-76075465 CCTAAAGGTCATGTGAAAAGTGG + Intergenic
992669061 5:79040572-79040594 CCAAAAGTACATGTGAACCAAGG + Intronic
994577054 5:101591414-101591436 CTAAAAGGAGAGGAGAAAAGAGG + Intergenic
1001382421 5:171313282-171313304 ACAAAAGGACAAGAGGACCGTGG - Intergenic
1001660589 5:173389592-173389614 CCCTAAGGACATGGGAAGCGGGG - Intergenic
1003124533 6:3345706-3345728 ACAAGAGGATAAGAGAAACGTGG + Intronic
1006765906 6:36506604-36506626 CCAAAAGGAAAGCAGAAACCTGG - Exonic
1009925229 6:70112756-70112778 CCAAAATGACAAGTGAAACCAGG + Intronic
1010825706 6:80471307-80471329 CCAAAAAGAAATGAGAAAGAAGG - Intergenic
1012218745 6:96621959-96621981 CCAAAAGGCAATGAGAAACCTGG - Intergenic
1013145126 6:107382389-107382411 CCAAAAGGATATGGGCAATGGGG + Intronic
1013340920 6:109214721-109214743 CCAAAAGAACATGATAATTGTGG + Intergenic
1014346108 6:120271792-120271814 CAAATAGGACATGTGAAACATGG - Intergenic
1015185256 6:130408549-130408571 CAAAGAGGACATGAGACATGTGG + Intronic
1016692834 6:146958375-146958397 CCAGAAGGAAAAGAGAAATGAGG + Intergenic
1016802400 6:148180005-148180027 CTGAAAGGAAATGAGAAAAGAGG + Intergenic
1017327256 6:153153468-153153490 GCAAAAGGACATTAGAGATGTGG - Intergenic
1017406581 6:154126143-154126165 CCAAACGGAAATGAGATAAGTGG + Intronic
1018538190 6:164846511-164846533 CCGAAAGGATATCAGAAATGAGG - Intergenic
1019460253 7:1154396-1154418 CCAAAAGGACAGGAGCACAGCGG + Intronic
1021685485 7:23181883-23181905 CCAATAGGACTTGAGAAGAGCGG - Exonic
1021964317 7:25902443-25902465 CCAAAAGACCATGAGAAAAAGGG + Intergenic
1022384246 7:29887048-29887070 CTGAAGGGACATGAGACACGAGG + Intronic
1030542667 7:110851627-110851649 CCAAAAGGAGAAGGGAAATGAGG + Intronic
1034891806 7:154846326-154846348 ACAAAAGGAAATGAGCAAGGGGG - Intronic
1038258064 8:25969409-25969431 TCAAAAGCACAGGAGAAACCTGG - Intronic
1040570745 8:48606976-48606998 CCAAAAGGAGAGGAGAAAGAGGG + Intergenic
1040654309 8:49487074-49487096 CCCAAAGGAAATCAGAAAAGAGG + Intergenic
1044086475 8:87948149-87948171 CCAAAAGTACAGGAGATACATGG + Intergenic
1048613381 8:136048408-136048430 CAAAAAGGGAAAGAGAAACGAGG - Intergenic
1049452352 8:142669107-142669129 CTAAGAGGCCCTGAGAAACGCGG + Intronic
1053515909 9:38730561-38730583 CAAAAGAGACATGAGAAATGTGG - Intergenic
1056084074 9:83127757-83127779 CCACAAGGATATGGGAAACCTGG + Intergenic
1056316784 9:85397929-85397951 CCAAAAGGAGATGAGCAAAAAGG + Intergenic
1057535173 9:95895489-95895511 CCAAAAGGACACAAAAAAAGTGG - Intronic
1059191899 9:112334062-112334084 CCACAAGGACCCCAGAAACGAGG + Intergenic
1059536091 9:115082314-115082336 CCAAAAGTACATGTGAAGCAGGG - Intronic
1191587285 X:62842334-62842356 ACAAAAGGACAAGAGAAACAGGG + Intergenic
1196235267 X:113272797-113272819 CAAAAAGGACATGTGAAAATAGG + Intergenic
1196643626 X:118092564-118092586 CCAAAAGAAAATGATAAAAGAGG + Intronic
1197998758 X:132409843-132409865 CCAAAAGGAAATGGAAAAGGAGG - Intronic