ID: 968388080

View in Genome Browser
Species Human (GRCh38)
Location 4:162739-162761
Sequence TTTTACAAATGTAATAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1345
Summary {0: 1, 1: 0, 2: 10, 3: 134, 4: 1200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968388077_968388080 20 Left 968388077 4:162696-162718 CCCAAACTTTCTTTGACATTAGA 0: 1
1: 0
2: 1
3: 21
4: 314
Right 968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG 0: 1
1: 0
2: 10
3: 134
4: 1200
968388078_968388080 19 Left 968388078 4:162697-162719 CCAAACTTTCTTTGACATTAGAG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG 0: 1
1: 0
2: 10
3: 134
4: 1200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968388080 Original CRISPR TTTTACAAATGTAATAAATT TGG Intronic
900010071 1:98542-98564 TTTTACAAATGCAATTTACTTGG - Intergenic
900026183 1:275126-275148 TTTTACAAATGCAATTTACTTGG - Intergenic
900035965 1:408979-409001 TTTTACAAATGCAATTTACTTGG - Intergenic
900618525 1:3576419-3576441 TTGTTCAAATGAAATAATTTGGG + Intronic
900773886 1:4567198-4567220 TTTTACAACTGGAAAAAATAAGG - Intergenic
901116778 1:6852137-6852159 TTTTAAAAATGTAAAAAAGAAGG + Intronic
902166501 1:14576152-14576174 TTTTACAAATGTGACAACTAAGG - Intergenic
902727302 1:18345794-18345816 TTTTACAAATGTGAAAACTGAGG + Intronic
902944995 1:19829128-19829150 TTTCCAAAATGTAATAAAGTTGG + Intergenic
903200285 1:21731578-21731600 TTTTAAAAATGAAATGAAATGGG + Intronic
903341137 1:22655164-22655186 TTTAACAACTTTAATAAGTTGGG - Intronic
903653191 1:24933288-24933310 CTTTACAAATGAAAGAAATGAGG - Intronic
903678073 1:25078307-25078329 TTTTAAAAATGTAAAAAAGAAGG + Intergenic
903782337 1:25828997-25829019 TTTTAGAAATGTAAAAACTGAGG + Intronic
904234859 1:29108855-29108877 CTTAACAAATAAAATAAATTGGG - Intronic
904874426 1:33643315-33643337 TTTTGCACATGTAATAAGTGTGG - Intronic
904968191 1:34396836-34396858 TTTTATAATTGTCATTAATTGGG - Intergenic
905127934 1:35729006-35729028 TTTTCCAAACGTGAAAAATTAGG - Intronic
906737035 1:48139919-48139941 TTTTACTAATAACATAAATTTGG - Intergenic
906803691 1:48759456-48759478 TTTTATAAATTTTATAAATGGGG + Intronic
906890201 1:49704482-49704504 TTCTACACATGTTATAATTTTGG - Intronic
907084458 1:51656977-51656999 AATTACAAATGTAAAAAAATAGG - Intronic
907380012 1:54079304-54079326 TTTTACAAATGGAAAAACTGAGG + Intronic
907871210 1:58445159-58445181 TCTGACAAATGTAAAAAATGGGG - Intronic
908057815 1:60309859-60309881 TTTTTCAAATTTGATAATTTCGG - Intergenic
908094078 1:60718968-60718990 TTTTATATATGTAATTTATTGGG - Intergenic
908263397 1:62355981-62356003 TTTTACAAATATAGGAAATAAGG + Intergenic
908694836 1:66827206-66827228 GTTTCTAAATGTAATAATTTAGG - Intronic
908983719 1:69990931-69990953 TTTTACAAAGGCAATAGAGTTGG + Intronic
909129558 1:71717153-71717175 TCTTACAAATGTAACATAATAGG - Intronic
909131571 1:71743165-71743187 TTTTACAAATGCCATAGACTGGG - Intronic
909138041 1:71826787-71826809 TTTTAGAAATGTAATTATGTAGG - Intronic
909225052 1:73008975-73008997 TTTAACCAATTTAAAAAATTTGG - Intergenic
909312103 1:74164751-74164773 TTTTAGAAAAGTAATACTTTTGG - Intronic
909369213 1:74864394-74864416 TTTGAAAAATTTAATAATTTGGG - Intergenic
909957541 1:81799165-81799187 TTTGACATATGTAAAAACTTAGG + Intronic
909997068 1:82293458-82293480 ATTTACATATATAATAATTTTGG - Intergenic
910174107 1:84410258-84410280 TTTTACAAACGTAATTAACTAGG + Intronic
910275893 1:85448842-85448864 TTTTACAAATTTTACAAAATTGG + Intronic
910306469 1:85769864-85769886 GATTACAAATGCAATAGATTAGG - Intronic
910355517 1:86349111-86349133 TGTTAAATATGTAATAATTTGGG - Exonic
910430666 1:87156661-87156683 TTTCACAAATGTCAAAAATCAGG - Intronic
910566935 1:88654355-88654377 TTTTACAAATGTATAAAAACTGG + Intergenic
910633073 1:89376967-89376989 TTTTAAAAAAGTAATCAATGAGG - Intronic
910825325 1:91400783-91400805 TTTTAAAAATAGAATAGATTTGG - Intronic
910958798 1:92738374-92738396 TTTTATAAATTTTATACATTAGG - Intronic
910996351 1:93108141-93108163 ATATAGAAATGTAATATATTTGG - Intronic
911125576 1:94338139-94338161 TTTAACAAATGTAAAAAAATGGG - Intergenic
911270305 1:95793546-95793568 TTTTACAAATGAGATAACTGAGG - Intergenic
911326939 1:96479603-96479625 TTTTAAAAAAAGAATAAATTTGG + Intergenic
911502205 1:98701535-98701557 TTGTACATATGTACTACATTTGG - Intronic
911600932 1:99847806-99847828 TTTACCAAATGTAATGCATTTGG + Intergenic
911771019 1:101742425-101742447 TTTTATAAATGTAAAAACATGGG - Intergenic
912179438 1:107200629-107200651 TTTTTAAAATGAAAAAAATTAGG + Intronic
912231067 1:107793394-107793416 TATTTCAAATGTCAGAAATTAGG - Intronic
912402889 1:109410420-109410442 TTTTACATGTGGAAGAAATTAGG - Intronic
912862000 1:113221892-113221914 TTTTACAAATTTATAAAATTTGG - Intergenic
912922044 1:113878237-113878259 TTTTACAAATGTAGAAACTAAGG + Intronic
912928723 1:113936721-113936743 TTTTAAAAATGTATTCATTTTGG - Intronic
913709015 1:121461520-121461542 TTTTACAAGTGGAAAAAATAAGG - Intergenic
914975426 1:152356527-152356549 TTTTCCAAATGTGATCAATATGG - Exonic
915766640 1:158369432-158369454 TTTCAGAGATGTTATAAATTTGG + Intergenic
915837646 1:159190478-159190500 TTTTACAAATGTAGGCAATGAGG - Intronic
916339537 1:163714259-163714281 TTTTGCACATTTAAAAAATTAGG + Intergenic
916526410 1:165613889-165613911 TTTTATAAATTAAAGAAATTAGG - Intergenic
916541096 1:165755338-165755360 TTTTTGAAATTTAATATATTTGG - Intronic
917010217 1:170462669-170462691 TTTACCAAATTTTATAAATTAGG + Intergenic
917049811 1:170908272-170908294 CTGTATAAATGTAATAAATGTGG + Intergenic
917119977 1:171636899-171636921 TTTTACAAATGCGATAACTGAGG - Intronic
917180350 1:172289962-172289984 TAATATAAATTTAATAAATTAGG - Intronic
917327839 1:173851403-173851425 TTTCACAAATGAAGAAAATTAGG + Intronic
917431962 1:174979273-174979295 TTTTCCAGATTTATTAAATTTGG + Intronic
917546589 1:175975382-175975404 TTTTTCAAGAGTAATAACTTCGG - Intronic
917816737 1:178718301-178718323 TATTACAAATCTTATTAATTGGG + Intergenic
918112227 1:181466859-181466881 TTTTACAAAGAGAATAAAATAGG + Intronic
918555520 1:185794846-185794868 TTTTACAAAAGTCATATTTTGGG - Intronic
919061526 1:192639926-192639948 TTTTATAAATTTAATGAAATTGG - Intronic
919089279 1:192958347-192958369 TTTTGCAAATGTAACATACTTGG - Intergenic
919261458 1:195199874-195199896 TTTTAGACATATAATAAAATAGG - Intergenic
919340207 1:196296688-196296710 TTTTCCCAATATAATAAATCAGG + Intronic
919433708 1:197530823-197530845 TTTTACAAATGTAAACATTAAGG + Intronic
919552750 1:199012353-199012375 TTTTACAAATTTATTTATTTTGG - Intergenic
919574094 1:199285004-199285026 TATTACAAATTTCATAAATCTGG - Intergenic
919665340 1:200285998-200286020 TTATACAAATGTAAGAAGTGAGG - Intergenic
920723194 1:208409032-208409054 TTTGACAAATGTATTCACTTTGG - Intergenic
920897655 1:210073547-210073569 TTTTACTTATGACATAAATTGGG - Intronic
920902141 1:210121105-210121127 TTTTACAAATGAAGAAAATGAGG - Intronic
921476031 1:215610763-215610785 TTTTACAGATGAAAAAAATAAGG - Intronic
922258503 1:223914547-223914569 TTTTACAAATGCAATTTACTTGG - Intergenic
922688959 1:227671882-227671904 TTTTTAAAATGTAAAAAAATAGG + Intronic
923044973 1:230349070-230349092 TTTTACAGATTTTATAAATTTGG + Intronic
923316953 1:232789738-232789760 GTTTCCAAGTGCAATAAATTTGG + Intergenic
923381222 1:233420180-233420202 TTTTAAAAATGTAATACAAGTGG + Intergenic
923438722 1:233994998-233995020 TTTTACAAATGTAATATCTGAGG - Intronic
923626742 1:235620198-235620220 TATTAAAAATATAAAAAATTAGG + Intronic
923834414 1:237594153-237594175 TTTTACAAATGAAAAAAAGATGG - Intronic
923907954 1:238407088-238407110 TTTTACCAATGAAGTAAATTAGG + Intergenic
924092435 1:240515280-240515302 TTTTACAAGTCTAATTAATTGGG + Intronic
924197863 1:241627220-241627242 TTTTATAATTATAATAAAATGGG - Intronic
924221039 1:241875307-241875329 TTTTTCAAGTTTAATAAATCAGG + Intronic
924288837 1:242516365-242516387 GTTTACTAATCTAATAAATTGGG + Intronic
924339699 1:243017309-243017331 TTTTACAAATGCAATTTACTTGG - Intergenic
924402018 1:243693337-243693359 TTTTAAAAATGTACTAAAGGGGG + Intronic
924764246 1:247016979-247017001 CCCTACAAATGTAATAATTTTGG + Intergenic
924764258 1:247017144-247017166 CTCTACAAATGTAATAAATGTGG + Intergenic
924785207 1:247189949-247189971 TCCTACAAATGTAAAAAATGTGG - Intergenic
1062876223 10:944930-944952 TTTAACAAATGTTAGCAATTTGG + Intergenic
1062990860 10:1815192-1815214 TATTACTAATTTAATATATTAGG + Intergenic
1063164500 10:3447913-3447935 TTTTTAAAAAGAAATAAATTAGG - Intergenic
1063196688 10:3749965-3749987 CTTTACAAATGTAATTAATGGGG - Intergenic
1063422772 10:5926726-5926748 GTTTACAAATGTAATTTTTTTGG + Intronic
1063442935 10:6088481-6088503 TTTTACATCTGTAATTAATTGGG - Intergenic
1064127380 10:12675106-12675128 CTTTACAAGTGTAACAACTTAGG + Intronic
1064333966 10:14421699-14421721 TTTTCCAAATGTATTGAAATAGG - Intronic
1064590355 10:16883950-16883972 TTTAAAAAATGAAAAAAATTGGG - Intronic
1065019324 10:21490701-21490723 TTTTACAGTTGTCATAAATCTGG - Intergenic
1065193608 10:23238696-23238718 TTTTAGAAATTTAATCAGTTCGG - Intronic
1065308368 10:24390167-24390189 ATCTACAAATATAATAAGTTAGG - Intronic
1065336955 10:24662600-24662622 TAATACAATTGTAATATATTTGG - Intronic
1065904753 10:30240427-30240449 TTTTTAAAAAATAATAAATTAGG - Intergenic
1066210931 10:33237525-33237547 ATTTTCAAATGTAAGCAATTGGG - Intronic
1066660061 10:37729453-37729475 TTTTTCAAATTTCATGAATTGGG + Intergenic
1066665294 10:37777019-37777041 TTTGGCATATGTAAAAAATTTGG - Intronic
1066718363 10:38311510-38311532 TTCTACCAATGGAATAGATTGGG - Intergenic
1067872264 10:49971787-49971809 TTTTACAAATGGTAAAAAATAGG - Intronic
1068081767 10:52327307-52327329 TTTTACAGATGAGATAACTTGGG + Intergenic
1068086906 10:52384865-52384887 TTTTAGAAACATGATAAATTTGG - Intergenic
1068174036 10:53434160-53434182 TTTTAAAAATTGATTAAATTTGG + Intergenic
1068244380 10:54345000-54345022 TGTTAAAATTTTAATAAATTTGG - Intronic
1068370399 10:56105778-56105800 TTTTACACATTTAATAAAATTGG - Intergenic
1068498084 10:57810733-57810755 TTTTACTAATCTATTAAAATGGG + Intergenic
1068701762 10:60027829-60027851 TTGTACAAATATAAGAAATGAGG + Exonic
1068746983 10:60543789-60543811 TTTGACAATTGTAATTAAGTAGG - Intronic
1069322915 10:67195239-67195261 TTTTACTAATGAAATAAATATGG + Intronic
1069847615 10:71383682-71383704 TTTTACAGATGAATTAAATGGGG + Intergenic
1070095308 10:73331893-73331915 GTTTACAAATGGTATAAAATTGG + Intronic
1070103168 10:73407554-73407576 ATTTACAAATTTAGAAAATTAGG - Intronic
1070138204 10:73714540-73714562 TTTTACAAATGGTAAAAAATAGG + Intergenic
1070181837 10:74021567-74021589 TTTTACAGATGTAATAGGTATGG - Intronic
1070256691 10:74819043-74819065 TTTTAAAAATGAGATAAAGTTGG - Intergenic
1070346400 10:75546926-75546948 TTTTACAGATGGAAAAACTTAGG + Intronic
1071743062 10:88384397-88384419 TTTTACACATGAAAAAACTTAGG + Intronic
1071745596 10:88415620-88415642 TTTTACAAATGGCAAAACTTAGG - Intronic
1071745759 10:88417295-88417317 TTTCACAAATTTTTTAAATTTGG + Intronic
1071867511 10:89752001-89752023 TTTTACAAATGAGGAAAATTAGG - Intronic
1072198923 10:93141524-93141546 TTTGACAACTGTAAGAAATATGG - Intergenic
1072509365 10:96103497-96103519 TTTTACAAATTTATTGAATATGG - Intergenic
1072886035 10:99275038-99275060 TTTTACAGATGTAGAAATTTGGG + Intergenic
1072931358 10:99665905-99665927 CTTAAGAAATGTACTAAATTTGG + Intronic
1073168976 10:101485555-101485577 TTTTACAAATCTAAAACTTTCGG + Intronic
1073870756 10:107861619-107861641 TTTCACTAATGTTGTAAATTGGG + Intergenic
1073972959 10:109065453-109065475 TATTAGAAATTTAATGAATTTGG - Intergenic
1074173191 10:110965909-110965931 TTTTACAAATCTTATAAAAAGGG - Intronic
1074476177 10:113776814-113776836 ATTTAAAAATGTAACAAATCAGG + Intronic
1074761355 10:116669659-116669681 TTTTATAAATGTGAAAAATAAGG + Intronic
1075314814 10:121444259-121444281 TTTTATAAATATTATAAATTTGG - Intergenic
1075760551 10:124852508-124852530 TATGACAAATGTAATAATTCAGG - Intergenic
1076072463 10:127501601-127501623 TTTTATCAATTTGATAAATTTGG - Intergenic
1078299282 11:10109123-10109145 TTTTGCATATGTATTTAATTTGG - Intronic
1078808404 11:14731610-14731632 TTTTACAGATGTGGGAAATTAGG + Intronic
1079070198 11:17338617-17338639 TTTTACAATTCTTATAATTTTGG + Intronic
1079152315 11:17911204-17911226 TTTTACAAATGAGAAAAATGAGG + Intronic
1079171855 11:18104321-18104343 TTTTAAAAATGTAGTACCTTGGG + Intronic
1079593387 11:22209438-22209460 TTTTACATATGTATTTAATGGGG + Intronic
1079659920 11:23023967-23023989 TATTTGAAATTTAATAAATTAGG + Intergenic
1079659958 11:23024482-23024504 TATTGAAAATTTAATAAATTAGG - Intergenic
1079781034 11:24605439-24605461 TTTTAAAAAGGAAACAAATTTGG - Intronic
1079868987 11:25771964-25771986 TGTAACAAATGTACTATATTTGG + Intergenic
1080754607 11:35184574-35184596 ATTTTCAAGTGTAATAATTTTGG + Intronic
1080755975 11:35199231-35199253 TTTTATAATTGTCAAAAATTTGG - Intronic
1081515705 11:43826512-43826534 TTTTCCTTTTGTAATAAATTTGG - Intronic
1082959971 11:58909392-58909414 TATTACAAAAGTAATAAATGAGG + Intronic
1083040148 11:59678137-59678159 TTTTACAAATCGAAAAATTTTGG - Intergenic
1083048536 11:59756732-59756754 TTTTACAAATGACAAAACTTAGG - Intronic
1083376560 11:62228019-62228041 CTTTACCAATGTATTCAATTGGG - Intergenic
1083427562 11:62596481-62596503 TTTTCCACATGTAATAAAACTGG + Exonic
1083566972 11:63727179-63727201 GTTTTAACATGTAATAAATTTGG - Intronic
1085134171 11:74070111-74070133 TTTTACAAATGAGACAAATAAGG - Intronic
1085363129 11:75911080-75911102 TTTTTAAAAAGTGATAAATTCGG - Intronic
1085699434 11:78733029-78733051 TTTTACAGATGAAAAAAATGAGG - Intronic
1085850943 11:80119244-80119266 TTTTAGAAAAATAATAATTTTGG + Intergenic
1085919473 11:80934990-80935012 ATTTACAAATGACTTAAATTTGG - Intergenic
1086012121 11:82118192-82118214 TTTTAAAAAGGTAAACAATTTGG + Intergenic
1086247217 11:84768084-84768106 TTTAACAGATGAAATAAAGTAGG - Intronic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086545998 11:87968189-87968211 TTTTACTTATGTTATAAATTTGG + Intergenic
1086616378 11:88825707-88825729 TTTTAGAATTAAAATAAATTAGG + Intronic
1087246433 11:95843678-95843700 TTTTGCAAATTTAATGAGTTTGG - Intronic
1087362835 11:97182327-97182349 TTCTACAATTGTATGAAATTTGG + Intergenic
1087536614 11:99454775-99454797 TTTTAAAAATGTAACAAAATTGG + Intronic
1087589203 11:100163933-100163955 TTTTACAAATGAAAGAATTGAGG + Intronic
1087748197 11:101973669-101973691 TTTTTAAAAAGCAATAAATTAGG + Intronic
1087774649 11:102246151-102246173 TTTAACACATGCAATAAAATGGG + Intergenic
1088059719 11:105632394-105632416 TTCTACAAATGAAAAAAATGGGG - Intronic
1088395919 11:109369502-109369524 TTTTACGGATATAATAAATGAGG - Intergenic
1088636931 11:111830873-111830895 TTTTAAAAAAGTAATGAGTTGGG + Intronic
1089170059 11:116505602-116505624 TTTTTAAAGTGTGATAAATTTGG + Intergenic
1090201439 11:124860649-124860671 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090750497 11:129742785-129742807 ATTTGCAAATGTCATAAACTGGG - Intergenic
1090753530 11:129768164-129768186 ATTTATAAATGTAATGATTTAGG - Intergenic
1091590565 12:1840572-1840594 TTTTACAAATGAAATGGCTTAGG + Intronic
1092666465 12:10805276-10805298 CTTAACAAAAGAAATAAATTGGG - Intergenic
1092872114 12:12814582-12814604 TTTTACAAATCTGATAAACATGG - Intronic
1093002099 12:14008803-14008825 TTTTTAAAATTTAATAACTTGGG - Intergenic
1093096352 12:14976151-14976173 TTTGACAAATATAATATATATGG + Intronic
1093186546 12:16026413-16026435 TTTCACAAATTTGATAACTTAGG + Intronic
1093206389 12:16256555-16256577 TTTTTAAAAAATAATAAATTAGG + Intronic
1093246240 12:16740773-16740795 TTTTAAAAATCTAGTAAATATGG + Intergenic
1093285857 12:17261680-17261702 TTTTAAAAAATAAATAAATTTGG + Intergenic
1093352703 12:18123497-18123519 TTTTAAAAATATGACAAATTAGG - Intronic
1093914189 12:24782417-24782439 TGTTACAAATGCAATAAAACTGG - Intergenic
1094005642 12:25747429-25747451 TTTTACAAATGACATAACTGAGG + Intergenic
1094187187 12:27657347-27657369 TTTTAAAAATGTATTTCATTCGG - Intronic
1094444580 12:30515866-30515888 TTTTAAAAATGTAACTAACTGGG - Intergenic
1094736065 12:33235077-33235099 TTACACAAATATAATAAATATGG - Intergenic
1095054060 12:37579792-37579814 TTTATCAAATGTAAAAAATATGG - Intergenic
1095190983 12:39257551-39257573 TTTTAAAATTGTAATAAACAGGG - Intergenic
1095479169 12:42616614-42616636 TTTTAGAAATCTCATAATTTTGG + Intergenic
1095568612 12:43655879-43655901 TATTCCAAATGAAATAAAATAGG + Intergenic
1095629787 12:44362131-44362153 TTTTGCAAAGGAAATAAACTAGG - Intronic
1095836165 12:46641245-46641267 TTTGAAAAATTTAATAAAATAGG + Intergenic
1096442699 12:51658800-51658822 TTTTAAAAAAGTAATTTATTGGG - Intronic
1096588694 12:52643145-52643167 TTTTAAAAAATGAATAAATTGGG + Intergenic
1096755917 12:53799372-53799394 TATAACAAATGTGATAAAGTAGG + Intergenic
1096868768 12:54580268-54580290 TTTTTAAAAAGTGATAAATTTGG - Exonic
1097148232 12:56956419-56956441 TTTTACAATTATACAAAATTAGG - Intronic
1097327167 12:58289897-58289919 TTTTACAAAGGTATTAAATGTGG + Intergenic
1097423928 12:59418053-59418075 TTTTACTTATGTTATAAAGTAGG + Intergenic
1097648730 12:62268157-62268179 TTTCATATATGTAATATATTTGG - Intronic
1097877351 12:64655723-64655745 TCTTAAAAATATCATAAATTTGG + Intronic
1097952046 12:65441819-65441841 TTAAACAAATTTAATATATTAGG + Intronic
1097997254 12:65901973-65901995 TTTTTCAAATATAATAAAAATGG + Intronic
1098068440 12:66645466-66645488 TTTTACAAAGGGATTAACTTTGG + Intronic
1098193992 12:67979912-67979934 TTTTAAAAATTTAATGACTTGGG + Intergenic
1098232339 12:68384668-68384690 TTTAACAAGAGTAATGAATTGGG + Intergenic
1098561952 12:71884432-71884454 TTTTACAAATGAAGTAACTGAGG + Intronic
1098575089 12:72032265-72032287 TTTTACAAATGGAATTATGTAGG + Exonic
1098724911 12:73951800-73951822 TTTTACAAATGTAATGATGGAGG - Intergenic
1098782408 12:74703658-74703680 CTTTAAAAATATATTAAATTTGG + Intergenic
1098901397 12:76115431-76115453 GTTTGCAAATGCAATGAATTGGG - Intergenic
1099083960 12:78221944-78221966 TTTTACAAACGTAACATTTTTGG - Intergenic
1099102325 12:78458433-78458455 TTTTACAAGGGTAATGAATTAGG + Intergenic
1100444490 12:94649121-94649143 TTTTACAGATTGAATATATTTGG - Intronic
1100578745 12:95918567-95918589 TTTCAGAAATGTAAAAAATGTGG + Intronic
1100733965 12:97506213-97506235 TTTTAATTATGTTATAAATTTGG - Intergenic
1101008102 12:100421738-100421760 TTTTATAAATGGAATAATCTTGG + Exonic
1101106327 12:101444075-101444097 ATTTAAAAAAATAATAAATTGGG - Intergenic
1101161956 12:101986630-101986652 TTTTCCACATTTGATAAATTCGG + Intronic
1101708491 12:107243069-107243091 TTTTACAAATGGGAAAACTTTGG + Intergenic
1102006547 12:109592647-109592669 TTTTACAGATGTAAAAACTGAGG + Intronic
1102312671 12:111859113-111859135 TTTTACAAGTCTAGTAATTTTGG + Intronic
1102563315 12:113778246-113778268 TTTTAAAAATGCAAAAAATATGG + Intergenic
1102779860 12:115554828-115554850 TTCCAAAAATGTAATAATTTGGG + Intergenic
1103672131 12:122626285-122626307 TTTAAAAACTGTAATAAATATGG - Exonic
1104156190 12:126135286-126135308 TTTTAAAAATGTGAGAAATATGG - Intergenic
1104186674 12:126439453-126439475 TTTTCCAAAGGTATTAAATTAGG + Intergenic
1104207517 12:126654118-126654140 TTTTCCAAATGTCTTAAATTGGG - Intergenic
1104600062 12:130147094-130147116 TTTTACTAATTTTAAAAATTGGG + Intergenic
1104622217 12:130324934-130324956 TTTTATAAATGAAAAAACTTAGG + Intergenic
1104685937 12:130784036-130784058 TTTTAGTAATGTAGTAATTTTGG - Intergenic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1105228736 13:18467218-18467240 CCATACAAATGTAATAAATGTGG - Intergenic
1105274566 13:18907076-18907098 TTTTTCAAATTTCATAAATCAGG + Intergenic
1105298906 13:19116214-19116236 TTTTTCAAATTTCATGAATTGGG - Intergenic
1105981431 13:25519894-25519916 TTTTAAAAATGTAATAAGATGGG - Intronic
1106205015 13:27584732-27584754 TTTAACAACTGTCATAAATTAGG + Intronic
1106268426 13:28131079-28131101 TTTTAAAAAAGTAATAAAAATGG - Intergenic
1106279759 13:28255831-28255853 TTTTAATACTGTAATATATTTGG + Intronic
1107002053 13:35559474-35559496 TTTGACAAATGTAATTTCTTAGG + Intronic
1107138182 13:36967523-36967545 TTTTACTTATGTATTAAATAGGG + Intronic
1107222853 13:38006180-38006202 TTTGAAAAATATAATAAAGTAGG - Intergenic
1107534379 13:41313450-41313472 TTTCACAATTGCAATAAATGTGG + Intronic
1107681117 13:42852006-42852028 TATCACCAATGAAATAAATTAGG + Intergenic
1107732963 13:43366778-43366800 TTTTACAGATATTATAAATGAGG - Intronic
1107934718 13:45335973-45335995 TTTTACAAGTGTAATCAACCAGG + Exonic
1108087431 13:46808604-46808626 TTTTAAAAATATAAAAAATTAGG + Intergenic
1108107853 13:47032161-47032183 TTTTAAAAAGGGAATAAATTTGG + Intergenic
1108300890 13:49074790-49074812 TTTTTCAAATGTCGTAAAATTGG + Intronic
1108504624 13:51101019-51101041 ATGTATAAATGTACTAAATTTGG - Intergenic
1108845877 13:54678103-54678125 TAAAACAAATGAAATAAATTAGG - Intergenic
1108939634 13:55936794-55936816 ATTTACAAATATAAAAAGTTAGG - Intergenic
1108945153 13:56013385-56013407 TTTTTCAAAACTAGTAAATTAGG - Intergenic
1109000037 13:56788818-56788840 CTTTACAAAGGTAAGAAATTAGG - Intergenic
1109189910 13:59311764-59311786 TTTTACAAATGAAAGAACTGAGG + Intergenic
1109628729 13:65014809-65014831 TTTTAAAAATGTCATATAATTGG + Intergenic
1109691002 13:65888745-65888767 TTTTACTAATGTCAAAATTTTGG + Intergenic
1109755286 13:66750640-66750662 TTTAACTAATGTAACAAAATAGG + Intronic
1109819236 13:67630983-67631005 TGTCACAACTGTAACAAATTGGG - Intergenic
1110105355 13:71668399-71668421 TTTCAGAAATGCAATAATTTTGG - Intronic
1110170778 13:72497838-72497860 TTAAACAAATGTAAGAAATTAGG + Intergenic
1110284173 13:73730521-73730543 ATTTACATATATAATAAGTTGGG - Intronic
1110319075 13:74139570-74139592 TTATATAAATATAATACATTTGG + Intergenic
1110492782 13:76128307-76128329 CTTTACAACTGTAAAAAAATAGG - Intergenic
1110811486 13:79815799-79815821 TTTTCCAAAAATAATAAAATGGG - Intergenic
1110933488 13:81253056-81253078 TGTAACAAATGTCATAGATTGGG + Intergenic
1111288865 13:86134618-86134640 TTATACAAATTTAATAGCTTAGG - Intergenic
1111349345 13:87005792-87005814 TTTTAAAAATGCTATAAATTAGG - Intergenic
1111381061 13:87452650-87452672 ATTGACAAATGTGATATATTTGG + Intergenic
1111456826 13:88495469-88495491 TTTGACAAATTTGACAAATTTGG - Intergenic
1111503151 13:89151838-89151860 TTTCACAAAAGTAATTACTTTGG + Intergenic
1111537699 13:89625566-89625588 TATTAGAAATGTAATATGTTGGG - Intergenic
1111555239 13:89872391-89872413 TTTTAAATATCTGATAAATTTGG + Intergenic
1111559192 13:89922819-89922841 TATTAAAAATGGAATAAATATGG + Intergenic
1111827344 13:93284072-93284094 TTATACATTTGTAATAAGTTGGG + Intronic
1111935412 13:94552041-94552063 TTTCACAAAGTTAATAAAGTAGG - Intergenic
1112266204 13:97926011-97926033 TATTAAAAATGTAACAAAATAGG - Intergenic
1112632629 13:101179429-101179451 TTCTACAAATGAATTGAATTTGG + Intronic
1112874742 13:104023068-104023090 TTTTAAAAATATAATTAAGTAGG + Intergenic
1113229020 13:108192516-108192538 TTATAAAAATGAAATAATTTGGG + Intergenic
1113341246 13:109428232-109428254 TTTTACAAATGAAACAACTGTGG - Intergenic
1114013015 14:18394082-18394104 CCATACAAATGTAATAAATGTGG - Intergenic
1114051497 14:18922168-18922190 TTTTTCAAATTTCATGAATTGGG + Intergenic
1114111064 14:19479756-19479778 TTTTTCAAATTTCATGAATTGGG - Intergenic
1114353934 14:21886722-21886744 ATTTCCAAAAGTTATAAATTTGG - Intergenic
1114966996 14:27974628-27974650 TTTTACTCATGTAATAAACAAGG + Intergenic
1114972636 14:28052802-28052824 TTTTAAAAATGAGAAAAATTAGG + Intergenic
1115627129 14:35204978-35205000 TTTTACAAATGTAAAAACTGAGG + Intronic
1115731865 14:36278276-36278298 TTTTACAAACATAATCAATTTGG + Intergenic
1115824852 14:37258344-37258366 TTCTACAACTGCAATAAAATAGG - Intronic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116180378 14:41524650-41524672 CTTTACAAATATAATAGTTTTGG - Intergenic
1116332952 14:43618076-43618098 TTTAACCAAAATAATAAATTTGG + Intergenic
1116394930 14:44436305-44436327 ATGAATAAATGTAATAAATTGGG - Intergenic
1116543326 14:46128951-46128973 TTTTTAAAATGTAATCTATTTGG + Intergenic
1116569259 14:46494741-46494763 TTATGTAAATGCAATAAATTCGG + Intergenic
1116854603 14:49940578-49940600 TTTTACAAATGGAGAAAATGAGG - Intergenic
1117036637 14:51736521-51736543 TTTTACAAATACAAATAATTGGG + Intergenic
1117248214 14:53908574-53908596 TTTCACAATTTTAAAAAATTGGG + Intergenic
1117282599 14:54255539-54255561 ATTTAAAAATGAAATATATTAGG + Intergenic
1117296991 14:54389485-54389507 TATTCCAAATTTAAGAAATTAGG - Intergenic
1117381988 14:55173715-55173737 TATTACAAAAGTATTAATTTGGG - Intronic
1117426790 14:55607890-55607912 TTTTACACATTTAAGAAATGGGG - Intronic
1117517428 14:56515710-56515732 TTTTACAAAGGTATTCAACTTGG - Intronic
1117578283 14:57123977-57123999 TTTTTAAAATGAAATAAACTTGG - Intergenic
1117662771 14:58024921-58024943 TGTTACTACTGTAATAATTTTGG - Intronic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1118008760 14:61589097-61589119 TTTTAAAAATATAATTAAATGGG + Intronic
1118242948 14:64079269-64079291 TTTTACAAGGGAAATAAATTTGG - Intronic
1118798401 14:69166715-69166737 TTTAATAAAGGTAAGAAATTGGG + Intergenic
1118965653 14:70581938-70581960 TTTTAAAAATTTAATATAATTGG - Intronic
1119021804 14:71122509-71122531 AGTTAGAAATGTAATAAAGTAGG - Intergenic
1119277620 14:73373383-73373405 TTTTACTAGTATAATATATTGGG + Intronic
1119755596 14:77116475-77116497 TTTTTCCAATGGAATAAATTTGG - Exonic
1120005523 14:79352790-79352812 TTTTACAAATGAAGTAACTAAGG + Intronic
1120083650 14:80244041-80244063 TCCTAGAAATGTAATATATTTGG - Intronic
1120173811 14:81272863-81272885 TTTTATAGATGAAAAAAATTAGG + Intronic
1120227225 14:81804392-81804414 TTTTACAAATGAAGAAAATGAGG - Intergenic
1120354849 14:83418995-83419017 TTTTACAAAAGTAAGCATTTGGG - Intergenic
1120446418 14:84602480-84602502 TTTTACATATGTGAGAAATATGG + Intergenic
1120490343 14:85170640-85170662 TTTTATAAATGTAAGAACTGGGG - Intergenic
1120513202 14:85440243-85440265 TTTCAGAAATGGAATAAATAGGG - Intergenic
1120608784 14:86613002-86613024 TTTTACAAATGAACTAAATGTGG + Intergenic
1121059586 14:90894013-90894035 TTTTACATTTGTAATCAAATTGG - Intronic
1121191757 14:92037045-92037067 ATTTACAAAATCAATAAATTAGG + Intronic
1121228718 14:92340800-92340822 TCTAAAAAATGTAATAAACTGGG - Intronic
1121450467 14:94004060-94004082 TTTTACAAATGAGAAAAATGAGG + Intergenic
1121474320 14:94182206-94182228 ATTTAAAAAAGTAATGAATTTGG + Intronic
1122142472 14:99671162-99671184 TTTTCCAAATGTACTATAATGGG - Intronic
1122159192 14:99770614-99770636 TTTTACAAATGGAGAAAATGAGG - Intronic
1122707693 14:103631378-103631400 TTTTAAAAATGTATAAATTTGGG - Intronic
1202940572 14_KI270725v1_random:141840-141862 CTCTACAAATGTAATTCATTTGG - Intergenic
1123962787 15:25423635-25423657 GTTTTAAAATATAATAAATTAGG - Intronic
1125010087 15:34862405-34862427 TTTTACAAATGGAGAAACTTAGG - Intronic
1125177234 15:36838266-36838288 TTTAAAAAATGAAATAAATGAGG + Intergenic
1125220587 15:37328661-37328683 TTTTACATTTGTAATACAATTGG - Intergenic
1126005183 15:44249717-44249739 TTTCAGAAATTTAAAAAATTCGG + Intergenic
1126127283 15:45306977-45306999 TTTTTGAAAGGTAATAATTTTGG - Intergenic
1126210513 15:46096176-46096198 TTTTAAAAAATTGATAAATTGGG - Intergenic
1126253958 15:46602953-46602975 TTTTAGCAATGTAAAAAACTTGG - Intergenic
1126254251 15:46606521-46606543 CCATACAAATGTAATAAATCCGG + Intergenic
1126262880 15:46714821-46714843 TTTCACAAATGTAACAAACATGG - Intergenic
1126353883 15:47774658-47774680 TTAAACAAATAGAATAAATTAGG + Intergenic
1126476933 15:49075183-49075205 TTTTAAAAATGTGATATAATAGG + Intergenic
1126754766 15:51915028-51915050 TCTTACGAATGTAATAATTTGGG - Exonic
1126927948 15:53612019-53612041 TTTTACAAATGTAGTAATTAGGG + Intronic
1127109648 15:55653954-55653976 TTTGACAAATGTATTACCTTAGG + Intronic
1127239102 15:57091369-57091391 TTTCTCAGTTGTAATAAATTAGG - Intronic
1127481190 15:59378909-59378931 TTCTCCAAATCTAAAAAATTTGG + Intronic
1128344425 15:66844568-66844590 TTTTACAGATGGAACAAACTGGG + Intergenic
1128423395 15:67516475-67516497 TTTTATAAAATTGATAAATTGGG - Intergenic
1128440370 15:67701997-67702019 GTTTACAAATGTAAAAACTGAGG - Intronic
1128753807 15:70167323-70167345 TTTTACAAATGAAGGAAATGAGG + Intergenic
1128946000 15:71821464-71821486 TTTTAAAAATTGAATACATTTGG + Intergenic
1129533121 15:76285523-76285545 TTTTTCAAATGTAAGAAGTTGGG - Intronic
1129560898 15:76566640-76566662 TCTTACCATTGTATTAAATTTGG - Intronic
1130057854 15:80544039-80544061 TTTTAAAAATGTACTAGATGGGG - Intronic
1130636329 15:85624148-85624170 TTTTACTAATTTTATAACTTTGG + Intronic
1130671856 15:85919858-85919880 TTTTACAAATGAAGAAACTTAGG - Intergenic
1130740522 15:86594620-86594642 TTTTAACATTGAAATAAATTTGG - Intronic
1130782224 15:87053203-87053225 TTTAACAAATGTATTAAACGGGG + Intergenic
1130901685 15:88212011-88212033 TTTGATTCATGTAATAAATTGGG - Intronic
1131081139 15:89536940-89536962 ATATATAAATGTAATAAATATGG + Intergenic
1131298169 15:91170585-91170607 TTTTAAAAATCTAACAAATCAGG - Intronic
1131369619 15:91868798-91868820 TTTTTAAAAAGTAATAAAATTGG + Intronic
1131676894 15:94679356-94679378 TTTAAAAAATGAAATAATTTTGG + Intergenic
1131790821 15:95963158-95963180 TTTTACTAAAGTAATAATTTTGG - Intergenic
1131797567 15:96035087-96035109 TTTTATAGATTTAAAAAATTGGG + Intergenic
1131891773 15:96979776-96979798 TTATTCCAATATAATAAATTAGG + Intergenic
1132007288 15:98239904-98239926 TTTTAAAAAAGTAAAACATTTGG + Intergenic
1133625617 16:7567985-7568007 ATTTTTAAATGAAATAAATTTGG - Intronic
1133931799 16:10238817-10238839 TTTTACAAATGAGAAAAATGAGG - Intergenic
1134271326 16:12735750-12735772 TATTACAAATAAAATAAATCAGG + Intronic
1134326864 16:13215460-13215482 TTTTAGAAATGCAAACAATTTGG + Intronic
1134333534 16:13272225-13272247 TTTTATAAAAGCAATAAAGTAGG + Intergenic
1134407544 16:13974612-13974634 TTTTAAAAATGTGACAAAGTCGG + Intergenic
1135782422 16:25315605-25315627 TATTACAATTGTAATATAGTTGG + Intergenic
1135933083 16:26756129-26756151 TTTTATTAATGAAATAATTTTGG - Intergenic
1136648859 16:31648113-31648135 TTTTACAAATATAAATGATTTGG + Intergenic
1137062657 16:35805913-35805935 TTGTAAAAATCTTATAAATTAGG - Intergenic
1138434971 16:56992929-56992951 TTTTAAAAATGTAAAACATTTGG + Intronic
1138785934 16:59846664-59846686 TTTTACTTATGTCAAAAATTTGG + Intergenic
1138882941 16:61038241-61038263 TTTTACACATCTATAAAATTGGG + Intergenic
1138964711 16:62070473-62070495 TTTTAAAAATGTAATTCATAGGG + Intergenic
1139111327 16:63894637-63894659 TTTTAAAAATGTAATCATTACGG + Intergenic
1139160223 16:64497119-64497141 TTTTCCAAATGTATTTACTTGGG - Intergenic
1139187996 16:64830165-64830187 ATTTATAAATTTAATAAATTAGG - Intergenic
1139715174 16:68807512-68807534 TTTAAAAAATTTAAAAAATTAGG + Intronic
1140150521 16:72359393-72359415 ATCTACAGATGTAATAATTTTGG - Intergenic
1140444494 16:75014142-75014164 TTTTAAAAATGAAATATTTTAGG + Intronic
1141025863 16:80547060-80547082 GTTTACAAAAGTAAAAGATTGGG + Intronic
1141726300 16:85791254-85791276 TTTCAGAAATGGAAGAAATTAGG - Intronic
1141869767 16:86776975-86776997 TTTTAAAAATTTACTAAATTTGG + Intergenic
1142454259 16:90208362-90208384 TTTTACAAATGCAATTTACTTGG + Intergenic
1144428330 17:15166785-15166807 TTTTAGATATTTAATATATTTGG + Intergenic
1144471877 17:15550834-15550856 TTTTTCTAATGTCATTAATTTGG + Intronic
1144594146 17:16552433-16552455 TGTTATAAATGTAATGAATGTGG - Exonic
1145106621 17:20123173-20123195 TTTTAAAAATGTTTTAAATGTGG - Intronic
1146104336 17:30018418-30018440 TTTTAAAAATGTATTGAATATGG + Intronic
1146467110 17:33095000-33095022 TTTTAAAAATGAGAAAAATTAGG - Intronic
1147293151 17:39460019-39460041 TTTTTAAAAAGTAATAAATGAGG + Intergenic
1147695402 17:42348676-42348698 TTTTAAAAATAAAATAAACTGGG - Intronic
1147735531 17:42635351-42635373 TTTTTAAAATGTAATAGAGTCGG - Intergenic
1149046357 17:52250508-52250530 TCTTACAAATATAATAAAAAGGG + Intergenic
1149073014 17:52565737-52565759 TTTTAAAAATTTAATAAATTTGG + Intergenic
1149161775 17:53702342-53702364 TTTTACAAATGAAATCTATATGG - Intergenic
1149182357 17:53954497-53954519 TCTTACAGATGTAATGAATGTGG + Intergenic
1149182396 17:53955250-53955272 TCTTACAAATGTCATACATATGG + Intergenic
1149512485 17:57255671-57255693 TTTTAAAAATGTAATAAGATAGG - Intergenic
1149527979 17:57372439-57372461 GTTTACAAATGTGGCAAATTTGG + Intronic
1149756218 17:59188411-59188433 TTGTACATATGTACAAAATTTGG - Intronic
1151017607 17:70575269-70575291 TTTTAAATATATATTAAATTTGG + Intergenic
1151128095 17:71866678-71866700 TTTCACAAAAGTAATAGATATGG - Intergenic
1151327308 17:73387264-73387286 TTTTTTAAATGTAGTAAATTAGG + Intronic
1151857420 17:76731665-76731687 TTCTGCAAATGTGATAAAATTGG - Intronic
1151889450 17:76943562-76943584 TTTTAAAAAAATAATAAAATGGG - Intronic
1152174777 17:78780703-78780725 TTTTAAAAAAGTAAAAAATTAGG + Intronic
1153152830 18:2114233-2114255 TTATTCAAATGTAATAATGTTGG - Intergenic
1153373059 18:4342378-4342400 TTTTTAAAATGTAAGATATTTGG - Intronic
1154007962 18:10549527-10549549 TTTTACAAATGAATTAACTGAGG - Intronic
1154314132 18:13290610-13290632 TCTTGCACATGTAAAAAATTAGG + Intronic
1154524727 18:15273080-15273102 CCATACAAATGTAATAAATGTGG + Intergenic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1155279336 18:24222403-24222425 TTTACCAAATATAATAAGTTGGG + Intronic
1155455154 18:26004272-26004294 TATTAGAAATGTTATTAATTAGG - Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1156070272 18:33198615-33198637 TTTTACAAATCGCATAAAATGGG - Intronic
1156649454 18:39207418-39207440 TTTTACAAATGGAATAATTGAGG + Intergenic
1156917409 18:42478037-42478059 TTTTGCAAATGAAAAAAACTAGG - Intergenic
1157049746 18:44148888-44148910 TTGTACAAATGTAGAAACTTTGG + Intergenic
1157056944 18:44240863-44240885 TTTTCCCAATGTAGAAAATTAGG + Intergenic
1157128424 18:44979871-44979893 TTTTGTAAATGTATTAAATGAGG - Intronic
1157462446 18:47911503-47911525 TTTCATAAATTTCATAAATTTGG + Intronic
1157600587 18:48890744-48890766 TTTTACAAATGAAAGAATTGAGG + Intergenic
1157929444 18:51805080-51805102 CTTTACAAAGGTAATAATTAAGG - Intergenic
1157993586 18:52527584-52527606 GTTTACATATGTAACAATTTAGG + Intronic
1158058616 18:53312444-53312466 TTTTAAAAATTTAAATAATTTGG - Intronic
1158614852 18:58977547-58977569 TTTTAAAAATGTAATCAGTCTGG + Intronic
1158700397 18:59740211-59740233 TTTTACACATGGAAGAAATAAGG - Intergenic
1158733128 18:60048016-60048038 TTTTAAAAAAATAAAAAATTGGG + Intergenic
1159056744 18:63473337-63473359 TTTTACAAATGTAAAGTGTTTGG + Intergenic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159171378 18:64772652-64772674 TTTTTCAGATTTGATAAATTTGG + Intergenic
1159243400 18:65773597-65773619 TTTTATAAATGAAAAAAATGAGG - Intronic
1159288101 18:66378415-66378437 TTTTAAAAATGTAATGAAAAAGG + Intergenic
1159792816 18:72804470-72804492 TTTTATAAATGAAAGAAATAGGG + Intronic
1159921266 18:74229401-74229423 TTTTAAAAATGTACAACATTTGG - Intergenic
1160044499 18:75374085-75374107 TATTACAAATAAAATAATTTGGG + Intergenic
1160095385 18:75867163-75867185 TTTTTCAAATGTGGTAAATAAGG + Intergenic
1160276179 18:77438758-77438780 ATTTTCAAATGTAAGAAATACGG - Intergenic
1160457607 18:79014280-79014302 TTTTCCAAATCCAATTAATTAGG - Intergenic
1160574886 18:79847662-79847684 TTTTTCAAATGTAATCAATAAGG - Intergenic
1162270505 19:9611133-9611155 TTTTCCACATGGATTAAATTTGG + Exonic
1162275792 19:9653681-9653703 TTTTCCACATGGATTAAATTTGG + Exonic
1162280269 19:9691071-9691093 TTTTCCACATGGATTAAATTTGG + Exonic
1163777019 19:19224762-19224784 TTTTACAAATGGAGTAACTCAGG - Intronic
1163872646 19:19835756-19835778 TTCTACAAATGTGATGAATGTGG + Intergenic
1163954432 19:20622922-20622944 TCCTGCAAATGTAATGAATTTGG - Exonic
1163961395 19:20697451-20697473 TCCTGCAAATGTAATGAATTTGG + Intronic
1164002782 19:21119590-21119612 TCATGCAAATGTAGTAAATTTGG + Exonic
1164009314 19:21184998-21185020 TTGTGCAAATATAATAAATTTGG + Exonic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164019999 19:21293184-21293206 TCCTACAAATGTGATAAATGTGG - Exonic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164141541 19:22471329-22471351 TTTTACAAATGTAAAGAATGTGG + Intronic
1164174118 19:22753471-22753493 ACCTGCAAATGTAATAAATTTGG - Intergenic
1164215823 19:23146227-23146249 TTTTACAAATGTGAAGAATGTGG + Exonic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164287454 19:23831964-23831986 TCCTACAAATGTAAAAAATGTGG + Intergenic
1164986823 19:32654341-32654363 TATTAAAAATGAAATAAAGTTGG + Intronic
1165613276 19:37175690-37175712 ATTTGAAAATGTAATAAAATAGG + Intronic
1165643688 19:37413915-37413937 TCTTACAAATGTAATGAATGTGG - Exonic
1165672779 19:37693590-37693612 TTTTTAAAAAGTAATAAATAAGG - Intronic
1167614066 19:50521873-50521895 TTTTAAAAATGAAAAAAATAAGG + Intronic
1167785749 19:51634891-51634913 TTTTAAAAATGTGAGAAAATAGG + Intronic
1167835329 19:52063671-52063693 TCTTACAAATGTAACGAATGTGG - Intronic
1167835542 19:52065570-52065592 CCTTACAAATGTAATGAATGTGG - Exonic
1167835612 19:52066326-52066348 CCTTACAAATGTAATGAATGTGG - Exonic
1167835625 19:52066494-52066516 CCTTACAAATGTAATGAATGTGG - Exonic
1167840676 19:52115836-52115858 ACTTACAAATGCAATAAATGTGG - Exonic
1167845009 19:52155164-52155186 CCTTACAAATGTAATGAATGTGG - Exonic
1167845021 19:52155332-52155354 CCTTACAAATGTAATGAATGTGG - Exonic
1167845094 19:52156172-52156194 CCTTACAAATGTGATAAATGTGG - Exonic
1167861832 19:52290767-52290789 CTTTACAAATGTAATAAATGTGG + Exonic
1167865416 19:52322190-52322212 CCTTACAAATGTAATGAATGTGG + Exonic
1167865428 19:52322358-52322380 CCTTACAAATGTAATGAATGTGG + Exonic
1167865434 19:52322442-52322464 CCTTACAAATGTAATGAATGTGG + Exonic
1167865437 19:52322526-52322548 CCTTACAAATGTAATGAATGTGG + Exonic
1167865451 19:52322694-52322716 CCTTACAAATGTAATGAATGTGG + Exonic
1167870571 19:52366405-52366427 CCTTACAAATGTAATGAATGTGG + Exonic
1167872553 19:52384631-52384653 CTTTACAAATGTAATAAATGTGG + Exonic
1167872567 19:52384799-52384821 CCTTACAAATGTAATGAATGTGG + Exonic
1167872590 19:52385135-52385157 TCTTACAAATGCAATGAATGTGG + Exonic
1167876312 19:52416158-52416180 CCTTACAAATGTAATAAATGTGG + Exonic
1167876331 19:52416410-52416432 CCTTACAAATGTAATCAATGTGG + Exonic
1167878906 19:52438685-52438707 CGTTACAAATGTAATGAATGTGG + Exonic
1167878925 19:52438937-52438959 CTTTACAAATGTAATGAATGTGG + Exonic
1167879122 19:52440813-52440835 CGTTACAAATGTAATGAATGCGG + Intronic
1167882651 19:52474050-52474072 CCTTACAAATGTAATGAATGTGG - Intronic
1167882669 19:52474302-52474324 CCTTACAAATGTAATGAATGTGG - Intronic
1167882678 19:52474454-52474476 CCTTACAAATGTAATGAATGTGG - Intronic
1167882704 19:52474873-52474895 CCTTACAAATGTAATGAATGCGG - Intronic
1167882715 19:52475124-52475146 CTTTACAAATGTAATGAGTGTGG - Intronic
1167896157 19:52583868-52583890 TCTTACAAGTGTAATAAATGTGG + Exonic
1167897961 19:52597084-52597106 TCTTACAAGTGTAATAAATGTGG + Intronic
1167899999 19:52613513-52613535 CCTTACAAATGTAATGAATGTGG - Exonic
1167904853 19:52650555-52650577 TATTAGAAAAGTAATAAGTTCGG - Intronic
1167905054 19:52652624-52652646 TCTTACAAGTGTAGTAAATGTGG - Intronic
1167911336 19:52704587-52704609 TCTTACAAGTGTAATAAATGTGG - Exonic
1167918931 19:52765489-52765511 TCTAACAAGTGTAATAAATGTGG - Exonic
1167923080 19:52799503-52799525 CTTTACAAGTGTAATGAATGTGG - Exonic
1167928153 19:52839853-52839875 TCTTACAAGTGTAATAAATGTGG - Exonic
1167930767 19:52862484-52862506 TCTTACAAGTGTGATAAATGTGG - Intergenic
1167935774 19:52906067-52906089 TCTTACAAGTGTAGTAAATGTGG - Intergenic
1167941527 19:52949727-52949749 ATCTACAAGTGTAATAAATGTGG - Exonic
1167943727 19:52969759-52969781 TGTTACAAGTGTAATGAATGTGG - Intergenic
1167956410 19:53068318-53068340 CCTTACAAATGTAATGAATGTGG - Exonic
1167956430 19:53068486-53068508 CCTTACAAATGTAATCAATGTGG - Exonic
1167956494 19:53069242-53069264 CCTTACAAATGTAATGAATGTGG - Exonic
1167961542 19:53108624-53108646 CCTTACAAATGTAATCAATGTGG - Exonic
1167965425 19:53141272-53141294 CCTTACAAATGTAATGAATGTGG - Exonic
1167965455 19:53141608-53141630 CCTTACAAATGTAATGAATGTGG - Exonic
1167968092 19:53164679-53164701 CCTTACAAATGTAATGAATGTGG - Exonic
1167968150 19:53165435-53165457 CCTTACAAATGTAATGAATGTGG - Exonic
1167968178 19:53165771-53165793 CCTTACAAATGTAATGAATGTGG - Exonic
1167977146 19:53237669-53237691 CCTTACAAATGTAATGAATGTGG - Exonic
1167987316 19:53329449-53329471 TCTTACAAGTGTAATAAATGTGG + Intergenic
1167987329 19:53329701-53329723 TCTTACAAATGTCATAAAGGTGG + Intergenic
1167990047 19:53351651-53351673 TCTTACAAGTGTAATGAATGTGG + Exonic
1167990086 19:53352239-53352261 CTTTACAAGTGTAATGAATGTGG + Exonic
1167990172 19:53353331-53353353 CCTTACAAGTGTAATAAATGTGG + Exonic
1167990209 19:53353915-53353937 TTTTGAAAGTGTAATAAATGTGG + Exonic
1167993630 19:53383729-53383751 TCTTACAAATGTAATAATTGTGG + Exonic
925139322 2:1539063-1539085 TTTTTCAGATGTAATTAGTTAGG - Intronic
925208906 2:2030711-2030733 TTTTACCAAATTAACAAATTTGG - Intronic
925487499 2:4351917-4351939 TTTTACAAATGAAAAAATTGAGG - Intergenic
926386594 2:12341418-12341440 TTTCTCAAATATAATAAACTAGG + Intergenic
927234700 2:20860229-20860251 ATTTTAAAATGTAATAAATATGG - Intergenic
927365325 2:22288486-22288508 TTTTACAAATATTACAAATGAGG + Intergenic
927565897 2:24112682-24112704 TTTTAGAAAACTATTAAATTAGG - Intronic
927660983 2:24992477-24992499 TTTTAGAAATCTAATCAATTTGG - Intergenic
928543233 2:32303405-32303427 TATTACAAATATTATAAAATAGG + Intronic
928647834 2:33373954-33373976 TTTTGCAAAAGTAAAGAATTTGG + Intronic
929019272 2:37535353-37535375 CCTTAAAAATGTAATAAATTTGG - Intergenic
929175728 2:38973620-38973642 TTTTACAAATGCAAAACAATTGG + Intronic
929347976 2:40910022-40910044 TTATCCAAATGTAAGAAAATGGG - Intergenic
929731613 2:44500578-44500600 TTTAACATATATAATAACTTGGG - Intronic
929855307 2:45632773-45632795 TTTTAAAAATGTAGCAAATCTGG + Intergenic
930101879 2:47609753-47609775 TTTTACCATTGCAAGAAATTGGG - Intergenic
930222196 2:48756011-48756033 TTTCACAAATGAAATAAAAGGGG - Intronic
930409086 2:51000720-51000742 TATTACAAATGAAATATTTTGGG + Intronic
930466229 2:51753746-51753768 TTTTACAAAGGAAATAATTTAGG - Intergenic
930485155 2:52002181-52002203 TTTTGTAAATGCAATAAATAAGG - Intergenic
930514977 2:52394796-52394818 TTTTACAAATATTCTAATTTGGG - Intergenic
930950618 2:57139667-57139689 GTTTATAAATGTAATACAATAGG + Intergenic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
931901416 2:66792933-66792955 TTTTAAAAAAGTATTAAATTTGG - Intergenic
932091078 2:68807041-68807063 TTTTAAATATGTAAGAAATGTGG + Intronic
932194566 2:69772176-69772198 TTTTACAGATGTAAAAACTGAGG + Intronic
932516705 2:72358561-72358583 TTTTACAAATGAAAAAAATAAGG + Intronic
932585298 2:73024060-73024082 TTTTACAGATGTGATAAAGTAGG + Intronic
932686416 2:73874371-73874393 TTTAACAAATTGTATAAATTGGG - Intergenic
932712752 2:74080090-74080112 TATAACAAATGAAATAAATGGGG - Intronic
932950280 2:76285224-76285246 TTTTACAAAAGTAACAAGTAAGG - Intergenic
933015822 2:77125755-77125777 TTTTTCAAATTCAATAAATTAGG - Intronic
933092622 2:78139474-78139496 TTTTAAAAATGTAAACAATGAGG - Intergenic
933441823 2:82324270-82324292 TTTTACAAAGGTTTGAAATTTGG - Intergenic
933526827 2:83451812-83451834 TTTTCTAAATGTCAAAAATTGGG - Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
933849042 2:86350617-86350639 TTTTATAGATGAAAGAAATTAGG - Intergenic
934033666 2:88070044-88070066 TTTTACAATGGTAATAAAAGTGG + Intronic
934537686 2:95149436-95149458 CCTTACAAATGTAATAAATGTGG - Exonic
934742469 2:96734961-96734983 TTTTTCTACTGTAATAAATTAGG - Intronic
935114564 2:100124079-100124101 TTTTAAAAATTTAAAATATTTGG + Intronic
935748177 2:106207834-106207856 CCTTATAAATGCAATAAATTTGG + Intergenic
936044350 2:109174651-109174673 GTTAATAAATGTAATATATTTGG + Intronic
936868183 2:117101460-117101482 TTTTTAAATTGTAATCAATTGGG + Intergenic
936982075 2:118274271-118274293 TTTTACTAGTGGTATAAATTTGG - Intergenic
937064535 2:119007337-119007359 TTTCACAAATGTAAAAACTGAGG + Intergenic
937254533 2:120545986-120546008 GTTTAAAAGTCTAATAAATTAGG + Intergenic
937589510 2:123596095-123596117 TTTGACACATTTAATTAATTAGG - Intergenic
938017925 2:127883516-127883538 TTTTACAAATGAAAGAACTGAGG - Intronic
938312668 2:130303071-130303093 TTTTTCAAATGTCATGAATCGGG + Intergenic
938523910 2:132105197-132105219 CCATACAAATGTAATAAATGTGG + Intergenic
938837775 2:135124933-135124955 TTTGAAAAATGTTATAAATCAGG - Intronic
938896515 2:135757065-135757087 ATTTACAGATGTAAGAAACTAGG - Intronic
939222700 2:139323400-139323422 TTTTAAAAATAAAATAAATGAGG - Intergenic
939232128 2:139442057-139442079 TTTTGCCAATCTAATATATTTGG + Intergenic
939378678 2:141405179-141405201 TTTTACTACTATAATAAATATGG - Intronic
939426850 2:142050240-142050262 CTTTAAAATTGTAATAAATGTGG + Intronic
939546442 2:143560404-143560426 TTTTACAGATGTAAAAACTGAGG + Intronic
939766008 2:146250845-146250867 TTTTACATATATAATATATATGG + Intergenic
939884837 2:147670366-147670388 ATTTACAAATATAAAAAATGAGG + Intergenic
939922844 2:148138287-148138309 TGTTACAGATGTAATAAATGAGG + Intronic
939955047 2:148520683-148520705 TTTTACTAACCTAAAAAATTGGG + Intergenic
940192238 2:151054200-151054222 TTTTACAAATGCAAAAACTGAGG + Intergenic
940415571 2:153415562-153415584 TTTTATAAATGCATTATATTTGG - Intergenic
940507442 2:154574179-154574201 TTTTACACAGGTAGTATATTTGG + Intergenic
941014615 2:160341011-160341033 TTTTAAAAATATTATAAAATTGG + Intronic
941273714 2:163463454-163463476 TATTACAAATGAAATCACTTCGG + Intergenic
941359231 2:164531562-164531584 TTTGACAAATATAATTATTTAGG + Intronic
941393443 2:164945116-164945138 TTTTAAAAATGAAGTCAATTTGG + Intronic
941703795 2:168635655-168635677 TTTTAAAAATGTAATAAAATAGG - Intronic
941815240 2:169789607-169789629 TTTTACCAATTTTATCAATTAGG - Intergenic
941849732 2:170167595-170167617 TTATTCAAATGTCATCAATTGGG - Intergenic
942341074 2:174947799-174947821 TATAACAAATATAACAAATTTGG + Intronic
942422519 2:175822497-175822519 TTTGACAAAGGGAATAAAATTGG - Intergenic
942437819 2:176000301-176000323 TTTTGCAAATGCAATAACTGAGG - Intronic
942666634 2:178326287-178326309 TTTTCCAAATGAAAAAACTTGGG + Intronic
942886871 2:180936584-180936606 TATAAAAAATGTAATAAATTAGG - Intergenic
942988610 2:182172424-182172446 TGTTACAAATGTAAAAACTATGG - Intronic
943008781 2:182420771-182420793 TATTACAAAGATAATAAATCTGG + Intronic
943085669 2:183307788-183307810 TTTAACAACTACAATAAATTCGG + Intergenic
943167316 2:184346242-184346264 TTTTACAAATGTAATTGCCTTGG + Intergenic
943282414 2:185953118-185953140 TTTTAAAAATGCTACAAATTAGG - Intergenic
943344308 2:186719877-186719899 GTTTCCAAATGTGAAAAATTAGG + Intronic
943505319 2:188748746-188748768 TTTTAAAAATGAAATATTTTTGG - Intronic
943820002 2:192309630-192309652 TTTTAAAATTCCAATAAATTTGG - Intergenic
943845254 2:192636349-192636371 TTTACCAAATGAAATAAATAAGG + Intergenic
943981975 2:194564865-194564887 TTTTCCAAATGTATTTAAGTAGG + Intergenic
944184729 2:196934916-196934938 TTTTACATATGAAAAAAATGAGG - Intergenic
944331587 2:198474450-198474472 TTTTATAATTGTCATAAAGTTGG + Intronic
944969334 2:204974171-204974193 CTTTACAGATGGAAGAAATTTGG + Intronic
945162219 2:206904378-206904400 TTTTAAAAATGCAGAAAATTTGG - Intergenic
945322980 2:208448130-208448152 TTTTACAAAGGGAATAAAATGGG - Intronic
945343652 2:208687048-208687070 TTTTCCAAATAAAATAAATTAGG + Intronic
945997250 2:216448016-216448038 TTTTAAAAATTTAAAAAATAAGG - Intronic
946482419 2:220069888-220069910 TTTAAAAAATGTAACAACTTTGG + Intergenic
946547020 2:220754988-220755010 ATGGACAAATGAAATAAATTAGG + Intergenic
946674681 2:222146278-222146300 TTTTACTGATGTAACAATTTTGG - Intergenic
946738081 2:222774475-222774497 TTTTATAAAAGTAATATATGTGG - Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947131907 2:226936349-226936371 TTTTTCAAATCTATGAAATTAGG + Intronic
947945759 2:234100737-234100759 TTTTGGAAATGTAATATTTTTGG + Intergenic
948185158 2:236015206-236015228 TTTAAAAACTGTAATAACTTGGG - Intronic
948364188 2:237444110-237444132 TTTTAGAAATATAAACAATTTGG - Intergenic
949085717 2:242153017-242153039 TTTTACAAATGCAATTTACTTGG + Intergenic
1168899190 20:1346262-1346284 TTTTGCCCATGTAAAAAATTAGG + Intronic
1169176551 20:3520803-3520825 TTTTACTAGTGTGATAAAGTTGG - Intronic
1169439472 20:5622234-5622256 TTTTAAAAATGTATTGACTTTGG + Intergenic
1169627220 20:7584895-7584917 TTTTACAAATGAGAAAAGTTAGG - Intergenic
1169671529 20:8107870-8107892 TTTTGCAACTGTAACAAAATAGG - Intergenic
1169873621 20:10272963-10272985 TTTCACAAGAGCAATAAATTTGG + Intronic
1169884233 20:10380838-10380860 TTTTGCAAATGAAATATGTTTGG - Intergenic
1170142508 20:13139023-13139045 TTTTAGAAATGTACTCAACTTGG - Intronic
1170379306 20:15739297-15739319 TTTCACAATTGTAAATAATTTGG + Intronic
1170651297 20:18245131-18245153 TTTTACAAATGAAGGAAACTGGG + Intergenic
1170864907 20:20145196-20145218 TTTTACATATGTTATAAACCCGG - Intronic
1171468134 20:25346942-25346964 TTTTAAAAAATTAATAAACTTGG - Intronic
1171804617 20:29663977-29663999 CTCTACTAATGTAATTAATTTGG + Intergenic
1171997591 20:31744100-31744122 TTTTAAAAATGAAATACAGTTGG - Intronic
1172333572 20:34094538-34094560 TTTTACACATGAAATATATATGG - Intronic
1172440780 20:34965052-34965074 TTTTAAAAATAAAATAAAATGGG - Intergenic
1172916769 20:38449097-38449119 TTTTCCAAATGAAGAAAATTAGG - Intergenic
1173133273 20:40414640-40414662 TCCTTCAAATGTAATAAAATTGG + Intergenic
1173753592 20:45495852-45495874 TGTTGCAAATGTAAGAAACTTGG + Intergenic
1173890136 20:46501186-46501208 TCTTATAAATGTAATGAATATGG - Exonic
1174637404 20:52013614-52013636 TTTTAAAAAATAAATAAATTTGG - Intergenic
1175456463 20:59118768-59118790 TTATCCAAATGTATTACATTCGG + Intergenic
1175603496 20:60294160-60294182 TTTCACAGATGTAAAAAATGAGG + Intergenic
1176582574 21:8545104-8545126 CTCTACAAATGTAATTCATTTGG + Intergenic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1176772716 21:13095405-13095427 CCATACAAATGTAATAAATGTGG - Intergenic
1176808336 21:13514277-13514299 TTTTTCAAATTTCATAAATCAGG - Intergenic
1176986242 21:15440944-15440966 TTTTTGAAATTTAAGAAATTTGG - Intergenic
1177282852 21:19006973-19006995 TTTAAAAAATCTAATAATTTAGG - Intergenic
1177287383 21:19069854-19069876 TGTAAAAATTGTAATAAATTGGG + Intergenic
1177335456 21:19719696-19719718 TATTACAAATAAAATAATTTTGG - Intergenic
1177400562 21:20598263-20598285 TTCTACAAATGTAAGTAATATGG + Intergenic
1177690346 21:24498610-24498632 TTTTAGAAACATAATAAATGTGG + Intergenic
1177736786 21:25101111-25101133 TTTTACAATTATAAAAAATATGG + Intergenic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
1179053573 21:37911383-37911405 TTTTACAAAATTATTAACTTTGG - Intronic
1179476206 21:41647620-41647642 ATTTACAAACCTAATAAATGAGG + Intergenic
1180265405 22:10522152-10522174 CTCTACAAATGTAATTCATTTGG + Intergenic
1180437509 22:15324898-15324920 CCATACAAATGTAATAAATGTGG - Intergenic
1180469970 22:15644544-15644566 TTTTTCAAATTTCATGAATTGGG + Intergenic
1180520359 22:16195115-16195137 ACATACAAATGTAATAAATGTGG - Intergenic
1181120288 22:20663472-20663494 TTTTAAAAATATAAGTAATTCGG - Intergenic
1182409981 22:30176421-30176443 TTTTACAAATATAATATAAAAGG - Exonic
1182543320 22:31057438-31057460 TTTTACAGATGTGATAACTAAGG - Intergenic
1182818696 22:33193246-33193268 TTTTTAAAAAGTAATAAAATGGG - Intronic
1183729891 22:39612304-39612326 TTTTAAAAAAGAAATTAATTTGG - Intronic
1183795681 22:40115460-40115482 TTTTACCAATGCATTTAATTAGG + Intronic
1183882413 22:40845465-40845487 TTTTAAAAATGAAAATAATTAGG - Intronic
1184314984 22:43679812-43679834 TTTTACCCATTTAAAAAATTAGG + Intronic
1184508843 22:44920140-44920162 TTTTTAAAATGGAATAAATGAGG - Intronic
1184532677 22:45066414-45066436 TTTTACCACAGTAAAAAATTTGG + Intergenic
1184619615 22:45666296-45666318 TTTTACAAATGAAAAAAAAAAGG + Intergenic
949095819 3:84218-84240 CTTTACAAATGGAAGAAATGAGG - Intergenic
949118894 3:361535-361557 TTTCAAAAATGTATTGAATTGGG + Intronic
949353357 3:3149643-3149665 TTTTACTACTTTAATAATTTTGG - Intronic
949468869 3:4372672-4372694 TGTTACAAATGTAAAAACTGAGG + Intronic
949746274 3:7296248-7296270 TTTTAAAAAGATAATACATTAGG - Intronic
950027641 3:9831653-9831675 TTTTGCAACTCTAATAAAATAGG - Intronic
950512244 3:13437772-13437794 TTCTAAAAATGTAATAAAAAAGG + Intergenic
951292907 3:20895859-20895881 TTTTCCTAATGTAATCACTTGGG - Intergenic
951611934 3:24499224-24499246 TTTTCCAGATGTTAAAAATTAGG + Intergenic
951817534 3:26770991-26771013 TTTTACAAATGAAGAAAATAAGG - Intergenic
951857647 3:27215480-27215502 TTTTAAAAATGTATTGCATTTGG - Intronic
951988692 3:28651065-28651087 TTTTAAAAATGCAATCTATTAGG - Intergenic
952102276 3:30028134-30028156 TTTTACAAATTTATTCAACTCGG + Intergenic
952288357 3:31990352-31990374 TCTTACAAGTGTAATAAATGTGG + Exonic
952462290 3:33540603-33540625 TTCTACATATATGATAAATTTGG - Intronic
952625922 3:35403262-35403284 TGATACAAAAGTAATAAGTTTGG - Intergenic
953443640 3:42942367-42942389 TTTTACAAAATTGATAAACTTGG + Intronic
953683252 3:45056116-45056138 TCTTAAAAATGTAGGAAATTAGG + Intergenic
954514003 3:51154740-51154762 TTTTAAAAATGAACTTAATTAGG + Intronic
954531793 3:51327341-51327363 TTTCACAAATGTAGAAACTTGGG + Intronic
954739201 3:52733937-52733959 CGTTATAAATGTAATAAATGTGG + Intronic
954895994 3:53975265-53975287 ATTTACAAAAGAATTAAATTAGG + Intergenic
955474741 3:59325305-59325327 TTTTACAAATGGAAAAACTAAGG - Intergenic
955563338 3:60217102-60217124 TTTTACAGATGTCACAAAATTGG - Intronic
955720647 3:61876868-61876890 TTCTAAAAATGTAATATTTTAGG - Intronic
956344866 3:68267254-68267276 TCTTACAAATGTTTTAAAATTGG - Intronic
956482024 3:69682500-69682522 TTTTAAAAATTTTAAAAATTAGG - Intergenic
956691699 3:71884351-71884373 TTTTACATAAGTTATAAATAGGG - Intergenic
956897784 3:73681502-73681524 ATTTACAAATGAAAAAAATGAGG + Intergenic
956903690 3:73743511-73743533 TTGAACAATTGTTATAAATTTGG - Intergenic
956914208 3:73853723-73853745 TTTTAAAAATAAAATAATTTTGG + Intergenic
957294728 3:78322482-78322504 TTTTTCAGATGTAACAAATAGGG + Intergenic
957306889 3:78468660-78468682 TTTGACAAATAAAATAACTTTGG - Intergenic
957333937 3:78801834-78801856 ATTTACAAATGTGATATATAAGG + Intronic
957379853 3:79413027-79413049 TATTAAAAAATTAATAAATTTGG - Intronic
957455370 3:80436465-80436487 TTTTCTAAAAGTAATAAATTAGG + Intergenic
957483645 3:80830418-80830440 TTTTAAAAGAGGAATAAATTTGG - Intergenic
957516575 3:81261670-81261692 TTTAATAAATGTGAGAAATTAGG + Intergenic
957710848 3:83857775-83857797 TTTTACATATGAAATAACTGAGG + Intergenic
957868716 3:86059898-86059920 TTTTAAAAAAGTAATATTTTTGG - Intronic
957933430 3:86912102-86912124 TTTTACAGGTGAAAAAAATTAGG - Intergenic
958267886 3:91461004-91461026 TTTTAAAAATATATTTAATTAGG + Intergenic
958552419 3:95633985-95634007 TTTTACAAATGAAGTAATTCAGG + Intergenic
958585078 3:96076594-96076616 TATTAAAAATGGAATAAATCTGG - Intergenic
958723683 3:97877348-97877370 TTTGAAAAAGGTACTAAATTAGG + Exonic
958891803 3:99791865-99791887 TTTTACAAATGAAGAAAAATAGG - Intronic
959035342 3:101356743-101356765 TCCTGCAAATGTAATGAATTTGG - Intronic
959185086 3:103036607-103036629 TTTTAAAAATGCAATAATTGAGG + Intergenic
959191279 3:103114070-103114092 TTTGGCAAATGTAATAGATAAGG + Intergenic
959230432 3:103643166-103643188 TATTAGAAATGTGATAATTTAGG + Intergenic
959243731 3:103835018-103835040 TTCTACAACTTTACTAAATTTGG - Intergenic
959337451 3:105083802-105083824 ATTTATAAATGTAAGAAATTGGG + Intergenic
959477570 3:106829791-106829813 TTTTACAAATTTATAAAATTTGG + Intergenic
959887395 3:111518343-111518365 TTTTAAAAATTTAATAAATATGG - Intronic
959930594 3:111978012-111978034 TTTTAAAATTGTAATAGATGTGG + Intergenic
960021061 3:112954317-112954339 TTTAACAAATTTAAGAAAATTGG - Intronic
960091871 3:113648533-113648555 TTTTACAAATGCATTGTATTAGG - Exonic
960340216 3:116465941-116465963 TTTTACAATTGGAATAACTGAGG + Intronic
960562623 3:119101722-119101744 ATTTGCAAATGTGAGAAATTAGG - Intronic
961545964 3:127633427-127633449 TTTTACAAATGAAATAACTGAGG - Intronic
961545977 3:127633564-127633586 TTTTACAAATGAAATAACTGAGG - Intronic
962426613 3:135274360-135274382 TTTCACAAATGTAAAAACTGAGG + Intergenic
962789417 3:138797616-138797638 TTTTCCAAAAGTAAGAAAATTGG + Intronic
962832872 3:139159543-139159565 TTTTACAGATGAAATAACTAAGG + Intronic
963364218 3:144313984-144314006 TTTTATAAATGAACTATATTTGG + Intergenic
963736361 3:149021640-149021662 TTTTACTAATGTGATAATTGAGG - Intronic
964468182 3:157021940-157021962 TTTTCCAAATGTATTACATTTGG + Intronic
964967000 3:162506848-162506870 ATTTTCAAATGTAAGAATTTAGG + Intergenic
965065064 3:163837919-163837941 TTTTACTTATTTGATAAATTAGG + Intergenic
965169773 3:165247772-165247794 TTTTAAAAAGTTAGTAAATTGGG - Intergenic
965193492 3:165562391-165562413 TTTTAAAAATGCAATATCTTGGG + Intergenic
965197297 3:165617501-165617523 TTTTACAATTGTATTATAATTGG + Intergenic
965921188 3:173916057-173916079 TTTCACAAATGTAAAAACTGAGG - Intronic
966370577 3:179247232-179247254 TTTTAAAAATGTGACATATTTGG - Intronic
966447030 3:180012229-180012251 ATTTACAAATAAATTAAATTAGG - Intronic
966543263 3:181115760-181115782 TTTTACAAATGATTTAACTTGGG + Intergenic
966808199 3:183822540-183822562 TTTGACAAATGTAACCACTTGGG + Intronic
967151627 3:186656068-186656090 TTTTCCAAATGTCATATAGTTGG - Intergenic
967277800 3:187793810-187793832 TTTTACACATTTTATAAATGAGG - Intergenic
967429304 3:189363142-189363164 TTACACAAATGAAATAAATTAGG - Intergenic
967483043 3:189997010-189997032 TTTTAAAAATGTGTTAAAATGGG - Intronic
967515094 3:190358957-190358979 CTTTAAAAAAATAATAAATTAGG - Intronic
967528290 3:190519416-190519438 TTTTACAAATGAAAGAACTGAGG + Intronic
967552777 3:190818083-190818105 TTTTAAAAATGAAATAAGTGTGG - Intergenic
968129748 3:196185938-196185960 TTTTAAAAATGTAAAAATTATGG + Intergenic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
968398750 4:269119-269141 TACGACAAATGTAATAAATGTGG - Intergenic
968409452 4:375380-375402 TCCTACAAATGTAATAAATGTGG + Intronic
968416543 4:441005-441027 TCCTACAAATGTAATAAATGTGG - Intronic
968696102 4:2028695-2028717 TGTAAAAAATGTAATAAACTTGG - Intronic
968871057 4:3242698-3242720 TGTTGCAAATGTGATTAATTTGG + Exonic
969147592 4:5137606-5137628 TTTTACAAATGAGATAACTGAGG + Intronic
969860435 4:10031606-10031628 GTTTAAAAATGAAATAGATTTGG - Intronic
970038257 4:11765262-11765284 ATATACAAATGTTATAAATATGG + Intergenic
970339588 4:15091234-15091256 TTATACAAATGAAATAATATAGG + Intergenic
970467367 4:16338658-16338680 TTTTACCCATTTAAAAAATTAGG + Intergenic
970739039 4:19211296-19211318 CTATACAAATGCAATAGATTGGG + Intergenic
970893756 4:21077846-21077868 TGTTCAAAATGTAATAAAATTGG + Intronic
971184223 4:24358288-24358310 TTTTAAAGATTAAATAAATTAGG - Intergenic
971489830 4:27199816-27199838 TATTACAAATGAAATACTTTAGG - Intergenic
971881693 4:32382957-32382979 TTTTACAAGTGTAGTCATTTTGG + Intergenic
972038488 4:34557443-34557465 TATTACAAATGTAAAAAATGTGG - Intergenic
972546751 4:40087351-40087373 TTTTTCAAAATTAAAAAATTAGG + Intronic
972803080 4:42497825-42497847 TATTTCAAATGTAACAAAGTTGG + Intronic
972829363 4:42796769-42796791 ACATACAAATGTAATAATTTTGG - Intergenic
973010531 4:45067392-45067414 TTTTAAAAATGTATTCATTTGGG + Intergenic
973306246 4:48654233-48654255 TTTTAAAAAATAAATAAATTAGG + Intronic
973695149 4:53483560-53483582 TTTTACTAAAGTGATAAATGAGG - Intronic
973913857 4:55612917-55612939 TTTTAAAATTGTATCAAATTTGG + Intronic
974128650 4:57727063-57727085 TTTAAGAAAAGTAATAGATTTGG - Intergenic
974195433 4:58568422-58568444 TTCTAAATATGTAATAAATTGGG - Intergenic
974405113 4:61457180-61457202 TGTTAAAAAAGTATTAAATTGGG - Intronic
974477602 4:62404245-62404267 TTTTACAAAGGAAAAAACTTAGG + Intergenic
974506353 4:62778648-62778670 TTCTACAAATGAAACAAACTTGG + Intergenic
974523610 4:63018462-63018484 ATTCACAAATGGAATAAATAAGG - Intergenic
974925216 4:68290106-68290128 TTTTAGAAATGGAAACAATTTGG - Intergenic
974985015 4:69012586-69012608 TTTTTCATTTATAATAAATTTGG - Intronic
975050214 4:69853973-69853995 TTCTACAGATGTAAAAACTTAGG + Intronic
975594951 4:76041317-76041339 TTATACAAATATAAAAAATAGGG - Intronic
975859410 4:78660276-78660298 TTATACAACTGTAATATGTTTGG - Intergenic
976042542 4:80905125-80905147 TTTTCCAAATTCAATAAATGAGG - Intronic
976820947 4:89206526-89206548 TATTTGAGATGTAATAAATTTGG + Intergenic
976852991 4:89570092-89570114 TTTGACAAATCTAAAAAAATGGG - Intergenic
976857207 4:89618695-89618717 TATTACAAATGTATTTCATTAGG - Intergenic
976862621 4:89684480-89684502 CTTTACTAATGTAATAGCTTTGG + Intergenic
977070907 4:92385736-92385758 TATTACAAATGTACAAAAGTAGG - Intronic
977269140 4:94893504-94893526 TTTTAAAAATTTCACAAATTTGG + Intronic
977569925 4:98618443-98618465 TTATACAAATGTAATTGCTTGGG - Intronic
977674908 4:99736288-99736310 TTTTACAGAAGAAATAATTTGGG - Intergenic
977808775 4:101335240-101335262 TTTGGCAAATGTAGTAAAATTGG - Intronic
978146461 4:105378411-105378433 TTTTAAAAATGTACAAAATATGG - Intronic
978237926 4:106482474-106482496 ATTTAAAAATCTAACAAATTTGG - Intergenic
978252316 4:106647380-106647402 TGTTACATATGAAATAAAATAGG + Intergenic
978276806 4:106961338-106961360 TTTTACAAAATTATTAAAGTTGG + Intronic
978277573 4:106970135-106970157 TTTTATAAATGTAAAAACTCAGG - Intronic
978600032 4:110418186-110418208 TCTTACAAGTGTAGTAAATGTGG + Intronic
978670506 4:111243245-111243267 TTTTCCAAATGTCATATAGTTGG - Intergenic
978722815 4:111932575-111932597 TTTTCAAAATGTTTTAAATTAGG + Intergenic
978780460 4:112547761-112547783 TTTTAGAAGTGAAGTAAATTGGG + Intronic
979065389 4:116125916-116125938 TTTTTAAATTGAAATAAATTTGG + Intergenic
979153433 4:117350623-117350645 TTTTACAAATGGAAATAATCTGG + Intergenic
979162766 4:117484770-117484792 TTGTACAAATAAAATAAAATAGG + Intergenic
979166414 4:117537757-117537779 TTTTTCAAATTTAATAGAATTGG + Intergenic
979263157 4:118671296-118671318 TTTTACAAATGCAATTTACTTGG + Intergenic
979397878 4:120210346-120210368 TTTTAAAAATATAATTACTTTGG + Intergenic
979593955 4:122512229-122512251 CATTACAATTGTAATAAGTTAGG + Intergenic
979828513 4:125270547-125270569 ATGGACAAATGTAACAAATTAGG - Intergenic
979843368 4:125475007-125475029 TGCTACATATGTAACAAATTTGG + Intronic
980199691 4:129639886-129639908 TTTTAAAAAGGTGTTAAATTTGG + Intergenic
980300782 4:130989517-130989539 TTTTACAAGTGTAATCAAACAGG - Intergenic
980441600 4:132854319-132854341 CTTTACAAATGTAATTCATTCGG + Intergenic
980455447 4:133034975-133034997 TTTAAAAAAATTAATAAATTTGG + Intergenic
980549036 4:134308923-134308945 TTTCACAAATCTAAAAATTTTGG + Intergenic
980701649 4:136440336-136440358 TTGTACAGATGAAAAAAATTGGG - Intergenic
980746070 4:137018321-137018343 TTTAACAAATGTAACTAATATGG + Intergenic
981039108 4:140205564-140205586 TTTTACATATGTAAAAATTCAGG - Intergenic
981391310 4:144194934-144194956 TTTTACAAATGAGATAATTTTGG + Intergenic
981679390 4:147378125-147378147 TTTTAGAAATTTTAGAAATTTGG + Intergenic
982404724 4:155006964-155006986 TTTTAAAAATGTAAGAAAATAGG - Intergenic
982993052 4:162303790-162303812 TTATACAAATATATTTAATTGGG + Intergenic
982996963 4:162361145-162361167 TTTTAGAAATGCAATGACTTTGG - Intergenic
983295138 4:165857403-165857425 TTTTCCTAATTTAATAAACTGGG - Intergenic
983307377 4:166008644-166008666 TTTAAAGAATGCAATAAATTTGG + Intronic
983492200 4:168400685-168400707 TTTTGCAAATAGAGTAAATTTGG - Intronic
983752322 4:171290248-171290270 CTTTAAAAAAATAATAAATTTGG + Intergenic
984078388 4:175212831-175212853 TTTTACAAATGTTATGAAATTGG - Intergenic
984265246 4:177490524-177490546 TTTTGGATATGTAATAATTTGGG + Intergenic
984414848 4:179445469-179445491 TTTTAAAAATGGATTATATTGGG - Intergenic
984505888 4:180618103-180618125 TTTTTCTCATGTAATAAATAAGG - Intergenic
984711883 4:182892694-182892716 TTTTGCAAATGTAACAACTTTGG - Intronic
985730819 5:1547543-1547565 TTTTACCACTGTGATAACTTTGG + Intergenic
985905078 5:2828252-2828274 TTTTCAAAATGAAATAATTTTGG - Intergenic
986013215 5:3735393-3735415 TCTTAGAAATGTAACAAATTAGG - Intergenic
986118819 5:4810056-4810078 TTTTAAAAATGTAATTTTTTTGG - Intergenic
986594514 5:9407506-9407528 TTTTAGAAATGTGTTAAATGAGG - Intronic
986622396 5:9689255-9689277 TTTTACAATAGTGATAAATTTGG - Intronic
986872206 5:12062212-12062234 TTTTACAAAAGTAAAATATTTGG - Intergenic
986922225 5:12700123-12700145 TTTTACTAACTTTATAAATTTGG + Intergenic
986950205 5:13073690-13073712 ATTTACAAAAGTATTAATTTTGG + Intergenic
987419554 5:17702775-17702797 CTTTACAAATGCTGTAAATTAGG + Intergenic
987515952 5:18908109-18908131 ATTTACAAATGTAAAAATTTGGG + Intergenic
987558917 5:19492783-19492805 TGTTAAATATTTAATAAATTGGG + Intronic
987744696 5:21955167-21955189 TTTTATAAATGAAAAAAAATAGG + Intronic
987869353 5:23593352-23593374 CTTTAAAAATGTAATAATCTTGG + Intergenic
988043583 5:25918719-25918741 TTTTAAAAAAGTAATAAAATAGG + Intergenic
988151004 5:27379768-27379790 ATTTAGATATGTAAAAAATTAGG + Intergenic
988318627 5:29663952-29663974 TTTTACATATGTCTTAAAATTGG + Intergenic
988414015 5:30922919-30922941 TATTAGAAATGACATAAATTTGG - Intergenic
988491004 5:31705686-31705708 TTTTAGAAATGGAAGAAATCAGG + Intronic
988652045 5:33163149-33163171 TTTATCAAATTTAATAATTTTGG - Intergenic
989005284 5:36804030-36804052 TTTTTGAAATAGAATAAATTGGG + Intergenic
989037531 5:37191368-37191390 TTTTACAAATAAAAAAAATTAGG + Intronic
989423748 5:41271630-41271652 TTTTACAAATGGACAAAATAAGG + Intergenic
989630653 5:43479487-43479509 TTTTAAAAAGGTAATAAAAAAGG + Intronic
989728829 5:44623341-44623363 TATAACAAATACAATAAATTAGG - Intergenic
990019196 5:51104422-51104444 GTTTAAAAATGTAATTCATTTGG + Intergenic
990049045 5:51472307-51472329 TTTTCCAAATCTTATAACTTAGG - Intergenic
990130095 5:52570899-52570921 ATAGACAAATGGAATAAATTTGG - Intergenic
990511041 5:56489154-56489176 TTTTACAGATGAAAGAAATAAGG - Intergenic
990680196 5:58234023-58234045 TGTAACAAATGCAATAAACTAGG - Intergenic
990728262 5:58780309-58780331 TTTTACAAAGCTTCTAAATTTGG + Intronic
991318261 5:65337498-65337520 TTTTACATTTGTAAGAAATATGG - Intronic
991327424 5:65451410-65451432 ATTCACTATTGTAATAAATTTGG - Intronic
991356734 5:65776432-65776454 TTTTACAGATTTAATTAGTTGGG + Intronic
991393636 5:66178615-66178637 TTTTGCAAATTTAAAAAACTGGG - Intronic
991667158 5:69010864-69010886 GTTCAAAAATGTAAAAAATTAGG - Intergenic
992422708 5:76622523-76622545 TTTTCCAAAAATAACAAATTTGG - Intronic
992522684 5:77571898-77571920 TTTTTCCAATGGAAGAAATTGGG + Intronic
992552723 5:77874625-77874647 TTTTAGAAAGGTCATAATTTAGG + Intergenic
993149697 5:84145276-84145298 TTTTATAGCTGTATTAAATTAGG + Intronic
993151571 5:84169605-84169627 TTTCAAAAATGTAATTAAATGGG + Intronic
993159614 5:84272951-84272973 TTTTAGAAATGTATTGACTTGGG + Intronic
993213994 5:84995390-84995412 TATGACAAATGTAATAACTATGG - Intergenic
993304840 5:86264135-86264157 TTTTATAAATGAAACAAAGTTGG - Intergenic
993526719 5:88974290-88974312 TTTTCCTAATCTCATAAATTTGG + Intergenic
993825490 5:92680588-92680610 TTTTACAAATGAGAAAAATGAGG + Intergenic
994833605 5:104818747-104818769 TTTAAGAACTGTCATAAATTTGG + Intergenic
994862664 5:105218344-105218366 TTTTCTTAATGTAAGAAATTGGG + Intergenic
994918836 5:106015569-106015591 TTTCCCAAATGTGATAAATGAGG + Intergenic
994939396 5:106302299-106302321 TTTTACAAATCTAAGAATTAGGG - Intergenic
994958615 5:106567539-106567561 TTTTACAAATGAGAAAAATTGGG + Intergenic
995140544 5:108730569-108730591 ATTTACAGATGTAAAAAATGAGG - Intergenic
995259906 5:110091504-110091526 TTTAAAAAATGTAACAGATTCGG - Intergenic
995281030 5:110335980-110336002 TTTTACAAATGGAATAATGAGGG + Intronic
995940575 5:117577784-117577806 TTTTACAACTGAAATTAATGAGG + Intergenic
995944491 5:117627165-117627187 TTTTAAAAATGTGATATATATGG - Intergenic
996063925 5:119061098-119061120 TTTTACTAATGTAGTAAGATAGG - Intronic
996206672 5:120746388-120746410 CTTTAAAAAAGTAAGAAATTTGG + Intergenic
996409932 5:123147115-123147137 ATTTACAAATGAAATGAATTTGG - Intronic
996505208 5:124260901-124260923 TTTTAAAAGTGGAATAAATCTGG + Intergenic
996647819 5:125838253-125838275 TTTAACAAAAGTAATAAATTTGG + Intergenic
996777142 5:127144855-127144877 TGTTACAAATATAATTAGTTAGG + Intergenic
996940850 5:129003668-129003690 CTCTACAAAAGTAAAAAATTAGG + Intronic
996944767 5:129053902-129053924 TTTTACAAATGAAAAAAACAAGG - Intergenic
996995026 5:129685530-129685552 TTTTATAAATGAAATATATTTGG + Intronic
997090655 5:130852991-130853013 TTTTAGAAATGTAATGGATTAGG - Intergenic
997237387 5:132280769-132280791 GTTTACAGATGTAAGAAATTTGG - Intronic
997375786 5:133396332-133396354 TTTTACAGATGAAGTAAATGAGG + Intronic
997433216 5:133855944-133855966 TTTTAAAAATGTAAAAGCTTGGG + Intergenic
997587121 5:135050131-135050153 GTTTAAAAATGTAAATAATTAGG + Intronic
998089238 5:139353585-139353607 TATTACAAATGTAATAATGGTGG - Intronic
998380149 5:141718665-141718687 TTTTACAAATGGAAAAAGTAAGG + Intergenic
998438330 5:142133446-142133468 TTTTACAGATGTGAAAATTTAGG + Intronic
998763529 5:145458787-145458809 TTTTACAAATGTTCTACAATGGG + Intergenic
998851214 5:146352558-146352580 TATTACACATTTTATAAATTAGG + Intergenic
999438737 5:151584706-151584728 TTTTACAAATGAAAAAACTGAGG + Intergenic
999836457 5:155378672-155378694 TTTAACAAATGGAACAAATTTGG - Intergenic
1000097147 5:157981479-157981501 TTTTAAAAATGTAATCCATTTGG - Intergenic
1000364034 5:160474536-160474558 TTTTATAAATGAAAAAAATTAGG - Intergenic
1000501028 5:162050243-162050265 TTTTACAAATGGGAAAAATAAGG + Intergenic
1000532694 5:162443787-162443809 TTTTACAAATGAAAAAACTGAGG + Intergenic
1000648952 5:163792058-163792080 ATTTTCAAATGAAATAAATCTGG - Intergenic
1000927083 5:167207123-167207145 TTTTAGAACTGGAATAAACTTGG - Intergenic
1000936255 5:167305869-167305891 TTTTAAAAATGGAATAACTGAGG + Intronic
1001309036 5:170597521-170597543 TTTTAGAAATGAGATAAATCTGG + Intronic
1001438798 5:171721987-171722009 TTTTACAATGGTAATAATTATGG + Intergenic
1001528911 5:172448733-172448755 TTTTACAAATGTAAAAACTAAGG + Intronic
1001585922 5:172834008-172834030 GTTTACAAATGCAAAAAACTGGG + Intergenic
1001706815 5:173747459-173747481 TTTTACAAATGAAAGAACTTTGG + Intergenic
1001731114 5:173959706-173959728 TTTTAAAAATGGAATAAAAGAGG + Exonic
1001970391 5:175950632-175950654 TTTTACAAATGAAAAAACTAAGG + Intronic
1002115392 5:176958749-176958771 TTTCAGAAATGTAATGAATAGGG + Intronic
1002150425 5:177224861-177224883 TCTTACAAATGTGACAAAATAGG - Intronic
1002247046 5:177893129-177893151 TTTTACAAATGAAAAAACTAAGG - Intergenic
1002366086 5:178712547-178712569 TTTTATAATTGTAATGAATGTGG - Exonic
1002393200 5:178932202-178932224 CCTTACAAATGTAACAAATGCGG + Exonic
1002619831 5:180480188-180480210 TTTTACAAATACAAAAACTTTGG + Intergenic
1002737856 5:181409885-181409907 TTTTACAAATGCAATTTACTTGG + Intergenic
1002844084 6:930853-930875 TTTTTCTAATGTAATTATTTAGG - Intergenic
1003018457 6:2488150-2488172 TTTTACATTTGTAATTAGTTTGG - Intergenic
1003288704 6:4759291-4759313 TTTAACAACTGTATTAATTTTGG - Intronic
1003339737 6:5208232-5208254 CTTTACAGATGTGGTAAATTAGG + Intronic
1003417566 6:5926121-5926143 TTTGACAAATGATATAAAGTTGG - Intergenic
1003469332 6:6414490-6414512 TTCTAAAAATTTAATAGATTTGG - Intergenic
1003575425 6:7289670-7289692 TTTTTCTAAAGTAACAAATTTGG - Exonic
1003685588 6:8298984-8299006 TTTTACAACTGTAGCAAATATGG + Intergenic
1003781030 6:9427067-9427089 TTGTACCAATGTAATATTTTTGG - Intergenic
1003934818 6:10964588-10964610 TTTTAAAAATTTAAAAAATTTGG + Intronic
1004000161 6:11590631-11590653 TTTTAATACAGTAATAAATTTGG + Intergenic
1004097512 6:12572924-12572946 TTTTATAAATGTTAAAAATGTGG + Intergenic
1004173151 6:13314863-13314885 TTTTATAAATGAGATAAATAAGG + Intronic
1004563133 6:16770449-16770471 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1004609049 6:17221497-17221519 GTGTATAAAAGTAATAAATTGGG + Intergenic
1004857014 6:19761483-19761505 TTTTACAAAGGCATTAAATAGGG - Intergenic
1004989023 6:21116227-21116249 ATTTACAAATGGCAGAAATTCGG + Intronic
1005140379 6:22625081-22625103 TTTTGCAAATTTCCTAAATTTGG - Intergenic
1005358870 6:25011204-25011226 TTTTATAAATTTTATAAATTAGG + Intronic
1005489079 6:26329983-26330005 CTTTACAAATGAGACAAATTGGG - Intergenic
1005598350 6:27401028-27401050 CCTTACAAATGTAATGAATGTGG + Exonic
1006233437 6:32605598-32605620 TGTTAAAAATGTAACACATTTGG - Intergenic
1006869863 6:37241703-37241725 TTTTAAAAATCTAATTAAATTGG - Intronic
1007140948 6:39573522-39573544 TTTCACAAAAGTAGTAAATTTGG - Intronic
1007299364 6:40855323-40855345 TTTTACAAATGTAAAAACTGAGG + Intergenic
1008140416 6:47825419-47825441 TTTTCTTAATGTAATAAGTTAGG + Intronic
1008143840 6:47865393-47865415 CTTTACAAATGTTATAAAAATGG + Intergenic
1008475879 6:51935149-51935171 TTTTAAAAATGGAATGTATTGGG - Intronic
1008618625 6:53250005-53250027 CTTTACAGATGTGTTAAATTAGG + Intergenic
1008695369 6:54029725-54029747 TTTTAGAAATGACATAATTTTGG - Intronic
1008699147 6:54078205-54078227 TTTTATAAATGTAAAATTTTAGG - Intronic
1008700588 6:54094988-54095010 ATTTACAAATGAATTACATTTGG + Intronic
1008703010 6:54124357-54124379 TTTCAAAAATATATTAAATTAGG - Intronic
1008776155 6:55040413-55040435 TTCAACACATTTAATAAATTCGG + Intergenic
1008891358 6:56496118-56496140 ATTCACAAAAGTAAAAAATTAGG + Intronic
1008987323 6:57560574-57560596 TTTTAAAAATATATTTAATTAGG - Intronic
1009175281 6:60453126-60453148 TTTTAAAAATATATTTAATTAGG - Intergenic
1009376505 6:62977636-62977658 TATTACAAATGTAATAACTCAGG + Intergenic
1009495562 6:64342226-64342248 TTTTAAAAATATAGTAATTTGGG + Intronic
1009542164 6:64974566-64974588 TTCTACAAATGTCAAAAATTTGG + Intronic
1009553347 6:65129037-65129059 TTTTACAAAAATAATCAATGAGG + Intronic
1009619623 6:66057292-66057314 TTTTATAAATTTTATAAATATGG - Intergenic
1009741552 6:67753559-67753581 TTTGACAGATGTATTCAATTTGG - Intergenic
1009810215 6:68652678-68652700 CTTTATAAATGTAATACATTTGG + Intronic
1010440596 6:75889290-75889312 TTTTAGAAATCCAATAATTTTGG + Intronic
1010576375 6:77536685-77536707 TTTTAAAAATATGATAAATATGG - Intergenic
1010781535 6:79950707-79950729 TTTTAAAAATTTAATACATCAGG + Intergenic
1010867274 6:80993945-80993967 TTTTAAAAGATTAATAAATTTGG + Intergenic
1011009732 6:82690184-82690206 TTTTCCAAATGTAAAAAACAGGG - Intergenic
1011125681 6:84004926-84004948 TTTTAAAAATATAATATATTTGG + Intergenic
1011155709 6:84328715-84328737 TAATACACATTTAATAAATTAGG + Intergenic
1011601971 6:89068116-89068138 TTTTAAAAATGACATAACTTAGG + Intergenic
1011872481 6:91913267-91913289 TTTCAAAAATATAATAATTTGGG - Intergenic
1011940745 6:92840005-92840027 TTTTACTAATGTAAAAACTATGG + Intergenic
1011962801 6:93112370-93112392 TTGTAAAAATGTACCAAATTGGG - Intergenic
1011982917 6:93406834-93406856 TTTTACATATGTAAATATTTCGG - Intronic
1012341181 6:98125832-98125854 TTTTGCAAATGTCATTAATCTGG + Intergenic
1012704998 6:102513434-102513456 CTTTACAAAAGTAATAGATGAGG - Intergenic
1012727885 6:102839523-102839545 TTTTACAAATGAAGTAACTGAGG - Intergenic
1013240882 6:108244473-108244495 TTTTACCACAGTAATAAATATGG - Intronic
1013323069 6:109014404-109014426 TTTTACAAGTTTTATAACTTTGG - Intronic
1013331123 6:109101213-109101235 TTTTAGAAGAGTAATTAATTAGG + Intronic
1013524178 6:110959080-110959102 TTTCACAAATGTGGGAAATTTGG + Intronic
1014001094 6:116367319-116367341 TTTTACAAATAGAATAATTTTGG + Intronic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1014187279 6:118449450-118449472 TTTTTCAAATGTGAAGAATTGGG - Intergenic
1014558937 6:122867146-122867168 TTTGAAAAAAGGAATAAATTTGG - Intergenic
1014772909 6:125477161-125477183 TTTTACAAATGATAAAAATAAGG - Intergenic
1014792924 6:125694868-125694890 TCTTATAAATGTAATAAATATGG + Intergenic
1015069724 6:129076981-129077003 TTATACTAATATAATAAGTTAGG + Intronic
1015352012 6:132231152-132231174 TTTTTCAAATATATTAACTTTGG - Intergenic
1015532077 6:134230711-134230733 CTCTACAAATAAAATAAATTAGG + Intronic
1015561175 6:134517676-134517698 TTTTACAGATGAGAAAAATTGGG - Intergenic
1015652199 6:135475912-135475934 TTTTAAAAGAGTAATAAAATTGG - Intronic
1015835379 6:137414993-137415015 TTTCACACATTTAATGAATTTGG + Intergenic
1016082539 6:139873542-139873564 ATTAACAATTGGAATAAATTAGG - Intergenic
1016173386 6:141047880-141047902 ATTTAGAAATGTAATTACTTAGG + Intergenic
1016251407 6:142047983-142048005 TTTTATAAAGGAAATAAACTTGG + Intergenic
1016443162 6:144105799-144105821 TATCACAAATGCCATAAATTGGG + Intergenic
1016539945 6:145153251-145153273 TTTTATTAATTTGATAAATTTGG - Intergenic
1016575629 6:145566844-145566866 TTAAAGAAATGTAGTAAATTAGG + Intronic
1016662417 6:146597058-146597080 TTTTAAACATCTATTAAATTAGG - Intergenic
1016917255 6:149255631-149255653 TTTGATAAATCTAATAAATCTGG + Intronic
1016979991 6:149845139-149845161 TTTTACAAATGAAAACAATGAGG - Intronic
1017245211 6:152217111-152217133 TTTTAAAAAAGTATTACATTAGG + Intronic
1017461043 6:154650750-154650772 TTTTACTATTGTAATTATTTTGG - Intergenic
1017472626 6:154754511-154754533 TTTTATAAACGTATAAAATTAGG - Intronic
1017931875 6:158963006-158963028 TTTTAGAAGAGTAAAAAATTAGG + Intergenic
1018149213 6:160922967-160922989 GTTTACATATGTAACAAACTTGG - Intergenic
1018293587 6:162318784-162318806 TTTCACAAATGTTATATCTTTGG - Intronic
1018406608 6:163490672-163490694 CTTTCAAAATGAAATAAATTTGG - Intronic
1018868652 6:167764682-167764704 TTTTAGAAATGAAAGACATTAGG + Intergenic
1019242955 6:170685443-170685465 TTTTACAAATGCAATTTACTTGG + Intergenic
1020027357 7:4908455-4908477 TTGTAAAAATGTAATACATCTGG + Intronic
1020048664 7:5064654-5064676 CTTTATAAATGTAATGAATGTGG + Exonic
1020364390 7:7365007-7365029 TTTTTCAAATAAAAAAAATTAGG + Intronic
1020398823 7:7750692-7750714 TTTTACAAATAAGATAAATGAGG + Intronic
1020399998 7:7765466-7765488 TTAAACAAATTTAATAATTTTGG + Intronic
1020539705 7:9444962-9444984 TTTTTCTAATGAAATAAATAAGG + Intergenic
1020614327 7:10439852-10439874 TATTAGAAATGCAATAAAATTGG - Intergenic
1020684619 7:11278171-11278193 TATTATAAATGGAATAATTTGGG + Intergenic
1021017617 7:15554008-15554030 TTTCACATATGTAATAAAAGGGG - Intronic
1021271727 7:18596393-18596415 TTTTATAAATATAATCCATTTGG + Intronic
1021298467 7:18939608-18939630 TTTTAGAAAAGTAATATATAAGG + Intronic
1021424501 7:20484642-20484664 AATTACAGATGTAAGAAATTAGG + Intergenic
1021466992 7:20955342-20955364 TTTTACACATGTAGGAAATGGGG + Intergenic
1021523474 7:21560274-21560296 TTTTACATATATAATATATTAGG + Intronic
1022191781 7:28023356-28023378 TTTTTCAAATATCATAAATGAGG + Intronic
1022214771 7:28247903-28247925 TGTTAGAAATGTTCTAAATTTGG - Intergenic
1022273802 7:28836763-28836785 TTTTACAAATGCAGTAACTGAGG - Intergenic
1022576158 7:31498877-31498899 ATTTTCAGATATAATAAATTTGG - Intergenic
1022614185 7:31911739-31911761 TTTTACAAATGGAAAAACTGAGG + Intronic
1022751794 7:33235840-33235862 TTTTAAAAATATATAAAATTTGG - Intronic
1023195480 7:37634085-37634107 TTTAAATAATGTTATAAATTGGG - Intergenic
1023285083 7:38610638-38610660 TTTTACAAATGTTACAAATGAGG + Intronic
1023491688 7:40749606-40749628 TTTACCCAATGTTATAAATTTGG - Intronic
1024014850 7:45304254-45304276 TTTTACAAATGTAACAAATGTGG + Intergenic
1024014856 7:45304333-45304355 TCTTACAAATGTAACGAATGTGG + Intergenic
1024331210 7:48157112-48157134 TTTTACAAATGCAAAAACTAAGG - Intergenic
1024404239 7:48959980-48960002 TCTTACATATTTAAAAAATTAGG + Intergenic
1024408435 7:49010199-49010221 TTTTTCAAATGTTCCAAATTTGG - Intergenic
1024462592 7:49673658-49673680 TGTTAAAAATGAAAAAAATTTGG - Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1025159280 7:56639663-56639685 TCCTACAAATGTAATGAATGTGG - Intergenic
1025688551 7:63740126-63740148 TTTTAAAAATGTATTAATTGGGG + Intergenic
1025727309 7:64078567-64078589 CCTTACAAATGTAATGAATGTGG + Intronic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1025772183 7:64520624-64520646 TCCTGCAAATGTAATGAATTTGG - Exonic
1025817399 7:64928025-64928047 TTCTACAAATGTAAGACATGTGG + Exonic
1027732545 7:81893855-81893877 TTTAACAATTTTAATAAATATGG - Intergenic
1027926549 7:84472004-84472026 TCTTAAAACTGTATTAAATTTGG - Intronic
1028178320 7:87683647-87683669 TGTTACTATTGTAATAATTTTGG - Intronic
1028322938 7:89485034-89485056 TTATACACATTTAACAAATTTGG + Intergenic
1028438038 7:90827775-90827797 ATTTATAAATTTAATATATTTGG + Intronic
1028481870 7:91315208-91315230 TTTTAAAAATGAAGCAAATTGGG - Intergenic
1028726581 7:94094827-94094849 TTTTATAAATTTAACAAATTAGG + Intergenic
1028851302 7:95541208-95541230 TTTTACAAATGAAAAAACTGAGG - Intergenic
1028856360 7:95597721-95597743 GGTTACAAATGTAATAGAATGGG + Intergenic
1028872396 7:95783855-95783877 TTTTACAGATGAAGAAAATTAGG - Intronic
1028997289 7:97115438-97115460 TTTTAAAAATGGATTTAATTTGG - Intergenic
1029242247 7:99171571-99171593 TTTTAAAATTTTAATTAATTTGG - Intergenic
1029299949 7:99573821-99573843 TCTTACAAATGTATTGAATGTGG + Exonic
1029352288 7:100022704-100022726 TTTTACAAATGACATAACTGAGG - Intronic
1029426964 7:100501579-100501601 TCTCATAAATGTAATAAATGAGG - Intergenic
1029939304 7:104463155-104463177 TTTGAAAAATGTAATAAGATAGG - Intronic
1030101614 7:105951565-105951587 TTTTAAAATTGTAAGACATTAGG + Intronic
1030121646 7:106115718-106115740 TTGTACAATTTAAATAAATTTGG - Intergenic
1030594157 7:111516522-111516544 TTTAAAAAGTGTAATAAAGTTGG + Intronic
1030642041 7:112017313-112017335 TTTTGGAAATGTTATAAAGTTGG + Intronic
1030734872 7:113036006-113036028 TTTTAACAATCTAATAAAGTTGG + Intergenic
1030815990 7:114038327-114038349 TTTTGCAAATGAAGTAGATTTGG - Intronic
1031293052 7:119964046-119964068 TTACACAACTGTAATAAATAAGG - Intergenic
1031315432 7:120252421-120252443 TCATACAAGTCTAATAAATTTGG + Intergenic
1031436229 7:121735351-121735373 TTTTATAAATGGAAAAAATAAGG - Intergenic
1031740906 7:125429404-125429426 TTTTACACATAAAATAAATAGGG + Intergenic
1031764050 7:125753150-125753172 CTTTAAAAATGTGATAGATTTGG - Intergenic
1031790828 7:126101717-126101739 ATTTTAAAATGTAATAGATTTGG - Intergenic
1032466219 7:132146958-132146980 TTTTACAAATTGAATAATTAAGG - Intronic
1032569165 7:132981726-132981748 CTTTATAAATGTAATACATAAGG + Intronic
1032699149 7:134363608-134363630 TTTTTCAAATGCAGTAAATGGGG - Intergenic
1032763100 7:134963650-134963672 TTATCCAAATGAAATTAATTAGG + Intronic
1032787798 7:135214344-135214366 TTTTAGAAATGCCATAAACTGGG + Intergenic
1033016102 7:137673149-137673171 TGTTGCAGATGTAATTAATTAGG - Intronic
1033043010 7:137935801-137935823 ATTTACAAATCAGATAAATTAGG + Intronic
1033388886 7:140907234-140907256 TTTTGCAAATCTATTAAGTTGGG + Intronic
1033726758 7:144126980-144127002 TTTCACAAATCATATAAATTAGG + Intergenic
1033746753 7:144325443-144325465 TATTAAAAATGCAAAAAATTAGG - Intergenic
1033764051 7:144468454-144468476 ATTTACAACTCTAATCAATTTGG + Intronic
1033861039 7:145628359-145628381 TTTAATAAATGGACTAAATTTGG + Intergenic
1034111964 7:148545930-148545952 TTTTTAAAATGTTATAGATTTGG - Intergenic
1034601480 7:152261630-152261652 AGTTACAAATACAATAAATTTGG + Intronic
1034622424 7:152466269-152466291 ATTTATAAATGTAATAAATATGG - Intergenic
1034910045 7:154988427-154988449 TATTATACATGTAATAAATTAGG - Intronic
1035505166 8:122719-122741 TTTTACAAATGCAATTTACTTGG - Intergenic
1035704649 8:1666369-1666391 TTTTACAAATGTATCCACTTTGG + Intronic
1035737622 8:1900091-1900113 TTTTTTAAATTTATTAAATTTGG + Intronic
1036294156 8:7521867-7521889 TTTTACAAATGTATAAATTTGGG + Intergenic
1036328406 8:7799124-7799146 TTTTACAAATGTATAAATTTGGG - Intergenic
1036494517 8:9257964-9257986 TTGTACAATTATAATAAAATGGG - Intergenic
1036538880 8:9683403-9683425 TTTTTCATATGTAGTAAATCAGG + Intronic
1036927034 8:12916985-12917007 TTTTACCAAAGTAATAAATACGG + Intergenic
1036981780 8:13477563-13477585 TTTTACAAATGGAAATAATCTGG + Intronic
1036988395 8:13564093-13564115 TTTTGCAAAAGTAATAATATAGG - Intergenic
1037211614 8:16395112-16395134 TTTTACAAATGGAAAAATTGTGG - Intronic
1037326134 8:17693215-17693237 TTTTACCAAAGTATTAAACTCGG - Intronic
1038075965 8:24074786-24074808 TTTAACAAATGTTATAAACTTGG + Intergenic
1038593905 8:28867916-28867938 TTTTACAGATGAAAAAAATGAGG + Intronic
1038966854 8:32583256-32583278 TTTTACAACTGTATTGAAATAGG + Intronic
1039607563 8:38894888-38894910 TTTTACAGATGGAAGAATTTAGG - Intergenic
1039678869 8:39706784-39706806 TTTCAGATATGTAATAATTTTGG + Exonic
1040645925 8:49396611-49396633 TTTTGTTCATGTAATAAATTTGG - Intergenic
1040666227 8:49636922-49636944 TTATAGAAATGCAATATATTTGG + Intergenic
1040809465 8:51435498-51435520 TTTAAAAAAAGTAATAAATTTGG + Intronic
1041287172 8:56273023-56273045 TTTTTCAAAGGTAACAATTTGGG - Intergenic
1041399124 8:57422520-57422542 TTTGATAAATTTAATTAATTTGG + Intergenic
1041409630 8:57539130-57539152 TTTTACAAATGCAAAAACTGAGG + Intergenic
1041461606 8:58117611-58117633 TTTTACAAATGAAGAAAATGAGG - Intronic
1041610437 8:59840401-59840423 TCTTATAAATAAAATAAATTTGG + Intergenic
1041631267 8:60090138-60090160 CTTTACAAATGTTTTACATTTGG + Intergenic
1041849305 8:62370692-62370714 TTTTACAATTTTAATACAATAGG - Intronic
1042009589 8:64226796-64226818 TTTTATAAATTTAAAATATTAGG - Intergenic
1042287412 8:67129150-67129172 GATTAAAAATGTAATAAAATAGG + Intronic
1042304873 8:67321075-67321097 TTTTAAGAATGTCATAAATGTGG - Intronic
1042361601 8:67889995-67890017 TTTTACATATGTACAAAATTTGG - Intergenic
1042458541 8:69034972-69034994 TTTTAAAAATCAACTAAATTGGG + Intergenic
1042616080 8:70650819-70650841 TTTTAGAATAGTAATAAAATTGG - Intronic
1042734006 8:71967533-71967555 TTGTACAAATTCAATCAATTTGG - Intronic
1042995036 8:74688266-74688288 ATATACAAAAGTAATATATTTGG - Intronic
1043044464 8:75303878-75303900 TTTTACAGATGTGGAAAATTAGG + Intergenic
1043053664 8:75410437-75410459 CTTTAAAAATATAATAAAATGGG + Intronic
1043815691 8:84798474-84798496 TTTTGCAAATGAAATAATTGAGG + Intronic
1043988871 8:86727860-86727882 ATTTACAAAAGTGATAAATCAGG + Intronic
1044767665 8:95593849-95593871 TTTTCCAAATTGAAGAAATTGGG - Intergenic
1044778460 8:95718842-95718864 TTTTACAAGTGAAAAAAAATGGG + Intergenic
1044890249 8:96827412-96827434 TTTTACTAAAGCAATAATTTAGG - Intronic
1044939508 8:97326301-97326323 TTTTAAAAATACAAAAAATTAGG - Intergenic
1045592670 8:103615599-103615621 TTTTAAAAAGTTAATAAAATAGG + Intronic
1045729069 8:105213536-105213558 TTTTAAAAATTTAATATATATGG - Intronic
1045795955 8:106044565-106044587 ATTTAAAAATGTATTAATTTAGG - Intergenic
1046153581 8:110258378-110258400 TCTTTAAAATGTAATCAATTAGG - Intergenic
1046241290 8:111497421-111497443 TTTTAAAAATTTAACAAAATTGG + Intergenic
1046253479 8:111665399-111665421 TTTTAAAAATTTAATTAAGTTGG - Intergenic
1046667171 8:117017080-117017102 TTTTACAAATTAAATAACTGGGG - Intronic
1046705501 8:117446031-117446053 TTTCATAAATGTAATAATTTTGG - Intergenic
1046728775 8:117703119-117703141 TTTTACAAATGCAATAAGAATGG - Intergenic
1046755509 8:117969061-117969083 TTTTACGAATGAAATAATTAGGG + Intronic
1046909083 8:119606150-119606172 TTTTACAACTTTAAAAAAATAGG - Intronic
1046910038 8:119616179-119616201 TTTTCCACATCTAACAAATTTGG + Intronic
1047011380 8:120676382-120676404 TTTTACATATGGAATAACTGGGG + Intronic
1047682642 8:127270140-127270162 TTTTACAAATGTAGAAATTGAGG + Intergenic
1047835083 8:128680639-128680661 TATAACAACTATAATAAATTTGG + Intergenic
1048201295 8:132376196-132376218 TTTTAGAAATATAATAATGTGGG - Intronic
1048489731 8:134881484-134881506 TTTTATAAATGTGATAACTGTGG + Intergenic
1048511934 8:135070789-135070811 TTTTACAAATGAAAAAACTGAGG - Intergenic
1048848690 8:138623675-138623697 TTTTTGACATGTAATAGATTTGG + Intronic
1050301956 9:4268194-4268216 TTTTACAAATGAAAAAACTAAGG - Intronic
1050304010 9:4288084-4288106 TTTTACCAATGTAAGAACTGAGG - Intronic
1050548216 9:6727033-6727055 TTTTACAAATATAAAGAATCGGG - Intronic
1050724706 9:8635541-8635563 TTTCACCATTGTAATTAATTAGG + Intronic
1050891455 9:10829701-10829723 TTTTACAAATGGAAAAACTGAGG - Intergenic
1050916629 9:11143263-11143285 TGTGACAAGTGAAATAAATTAGG + Intergenic
1051086338 9:13353512-13353534 ACTTACACATGTACTAAATTGGG + Intergenic
1051268940 9:15336038-15336060 ATATACAGATGTAATAACTTTGG - Intergenic
1051904782 9:22082683-22082705 TTTTATACCTGTAGTAAATTGGG + Intergenic
1051979723 9:22999266-22999288 TTGTACAAATTGAATAAATTGGG - Intergenic
1052208808 9:25876167-25876189 TCTTACAAATCAAATAAATGGGG - Intergenic
1052282361 9:26747873-26747895 TAATAAAAATGTAATAAATTAGG - Intergenic
1052656331 9:31366800-31366822 TTCTACACATGTTATAATTTTGG - Intergenic
1053089125 9:35257285-35257307 TTTTATAAATATAAAAAATGGGG - Intronic
1053383069 9:37664790-37664812 CCTTATAAATCTAATAAATTAGG + Intronic
1053655204 9:40211973-40211995 TTTTACAAATGAATTAAAGGTGG + Intergenic
1053702656 9:40712805-40712827 CCATACAAATGTAATAAATGTGG + Intergenic
1053905588 9:42841209-42841231 TTTTACAAATGAATTAAAGATGG + Intergenic
1054367320 9:64358189-64358211 TTTTACAAATGAATTAAAGGTGG + Intergenic
1054412716 9:64836269-64836291 CCATACAAATGTAATAAATGTGG + Intergenic
1054529395 9:66164341-66164363 TTTTACAAATGAATTAAAGGTGG - Intergenic
1054674950 9:67847926-67847948 TTTTACAAATGAATTAAAGGTGG + Intergenic
1054916710 9:70501163-70501185 TTTTAAAAATGGATTAGATTGGG + Intergenic
1055014887 9:71605776-71605798 TTTTTGTAATGTAATAAAATAGG + Intergenic
1055761083 9:79608844-79608866 TTTTAAAAACATAATAAACTTGG - Intronic
1056039648 9:82650037-82650059 TGTTAAAAAAGTGATAAATTGGG - Intergenic
1056162850 9:83914545-83914567 TTTCACAAATGTAAAATATATGG - Intronic
1056266603 9:84902851-84902873 TTTTACAGATGAAATAACTAAGG - Intronic
1056275930 9:84994202-84994224 AATTACACATGTAATAAATGTGG - Intronic
1056357500 9:85816987-85817009 TTTCACAAATGTAAAATATATGG + Intergenic
1057098710 9:92337365-92337387 TTTTGCAAAGATAATCAATTTGG + Intronic
1057099470 9:92344481-92344503 TTTTAAAGATGTAATTTATTTGG + Intronic
1057372153 9:94483784-94483806 TTTTACAAATGAATTAAAGATGG + Intergenic
1057600561 9:96453372-96453394 TATTAAAAATATAAAAAATTAGG - Intronic
1057640814 9:96819277-96819299 TCTTACAATTTCAATAAATTTGG - Exonic
1058137450 9:101322642-101322664 TTTTATACATGTAATCAACTAGG - Intronic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1058321697 9:103639767-103639789 ATTAACAAATGTTATCAATTAGG + Intergenic
1058456504 9:105142708-105142730 TTTAAAATATGTCATAAATTTGG - Intergenic
1058611674 9:106783831-106783853 TTTTACAAATGAAACAACTAAGG + Intergenic
1058668196 9:107339375-107339397 TTTTACAAATGGGATAACTGAGG + Intergenic
1058703215 9:107618098-107618120 TTTTACAAATGAAAAAACTGAGG - Intergenic
1058725404 9:107798781-107798803 TTTTACAGCTGTAATAACTTAGG - Intergenic
1058859347 9:109099582-109099604 TTTTACAAATGAAGAAACTTAGG - Intronic
1059851691 9:118348298-118348320 TTTTTCTAATTTAATAAATGAGG + Intergenic
1060249962 9:121978410-121978432 TTTTACCTATGTGATAAACTGGG + Intronic
1060450329 9:123732701-123732723 TTTTTCAAAATTAATAGATTTGG - Intronic
1060461539 9:123859785-123859807 TTTAAAAAATGTATGAAATTTGG + Intronic
1061240332 9:129367134-129367156 TTTTGAAAGTCTAATAAATTAGG + Intergenic
1203603146 Un_KI270748v1:34667-34689 TTTTACAAATGCAATTTACTTGG + Intergenic
1203612592 Un_KI270749v1:23116-23138 CTCTACAAATGTAATTCATTTGG + Intergenic
1185963524 X:4573475-4573497 ATTTACATTTGTAACAAATTTGG - Intergenic
1186001293 X:5014425-5014447 TGATACAAGTGTAATAAAATTGG + Intergenic
1186747841 X:12587878-12587900 TTTTAAAAATGTGTTAAGTTTGG - Intronic
1186815345 X:13231714-13231736 TTTTTGAAATGGAATAAACTTGG + Intergenic
1186972141 X:14858716-14858738 TTTTACAAATGAAAAAACTGAGG + Intronic
1187544191 X:20231490-20231512 TTTTACAAAAGTAAAAAGGTGGG + Intronic
1187995259 X:24919490-24919512 TTTTACAAATGGAAAAACTGAGG - Intronic
1188021626 X:25164943-25164965 TGTTATAAATGTAACAAATGTGG + Intergenic
1188574664 X:31632438-31632460 TTTTTAAAATGTGATAAATTAGG + Intronic
1188786090 X:34348277-34348299 TTTCACAAATGTGAAACATTTGG - Intergenic
1188922873 X:36000320-36000342 TATTACAAATGGAATAATCTGGG - Intergenic
1189501308 X:41562008-41562030 TTTTACAAATGTGAAAACTGAGG - Intronic
1189726944 X:43976715-43976737 TTTTACAAATGGAAAAACTGAGG + Intergenic
1190243065 X:48672779-48672801 TTCTAAAAATATAAAAAATTAGG + Intergenic
1191823909 X:65342885-65342907 TTTTAGAAAATTAATAAAATAGG + Intergenic
1193107687 X:77696266-77696288 GTTTAAAAATTTAATATATTAGG - Intronic
1193141214 X:78029063-78029085 TTTTATGAATATAAGAAATTGGG - Intronic
1193302695 X:79909863-79909885 TTTTGCAACTGTACTAAATAAGG + Intergenic
1193608873 X:83604027-83604049 TTTAATAATTGTAATAAATAAGG - Intergenic
1193619957 X:83739284-83739306 TTCAACAAATGAAATAAATAAGG + Intergenic
1193733305 X:85127488-85127510 TTTTACAAATGGAAAGAATGAGG - Intergenic
1193835050 X:86332694-86332716 TTTTAAAAAAGTATTCAATTTGG - Intronic
1194137102 X:90159192-90159214 TTTTACAATTGGAAAAATTTAGG + Intergenic
1194204269 X:90993674-90993696 TTTTAGAACTGTATGAAATTTGG + Intergenic
1194222870 X:91217295-91217317 TTTTAGAACTGTATGAAATTTGG - Intergenic
1194336427 X:92652479-92652501 TTTTACAGATGGAATGAGTTTGG - Intergenic
1194793834 X:98184979-98185001 TGTGACAATTGTAATAAATGTGG + Intergenic
1194869839 X:99115919-99115941 TTTTACAGATGAAAAAAATGAGG + Intergenic
1194928401 X:99857381-99857403 TTTGAGAAATTTAATGAATTAGG - Intergenic
1195009376 X:100720286-100720308 TTTTAAAAATCTAAAAAATGGGG - Intronic
1195118140 X:101720495-101720517 ATCTACAAATGTAATAAATGTGG - Intergenic
1195118150 X:101720660-101720682 CCCTACAAATGTAATAATTTTGG - Intergenic
1195166857 X:102228543-102228565 TTTTAAAAAAGTATTAATTTTGG + Intergenic
1195192003 X:102458545-102458567 TTTTAAAAAAGTATTAATTTTGG - Intronic
1195201796 X:102558287-102558309 TTCTACAAATGTCATCAATAAGG + Intergenic
1195211849 X:102657392-102657414 TTTTATTAATGGAAAAAATTCGG + Exonic
1195365484 X:104121021-104121043 TATAACAATTGTAATAAATCAGG - Intronic
1195376584 X:104233963-104233985 TTGTACAAATTTCATAAATGTGG + Intergenic
1195410289 X:104563092-104563114 TTTTAAAAATGTTATCAATTGGG - Intergenic
1195920261 X:109976595-109976617 TTTTAGAAATGCATAAAATTGGG + Intergenic
1196133191 X:112179758-112179780 TATTTCAAATATAATATATTAGG + Intergenic
1196244189 X:113379539-113379561 ATTTACAAAGGAGATAAATTAGG - Intergenic
1196346031 X:114660055-114660077 ATTTACACATGTAGTAAAATCGG + Intronic
1196490316 X:116257617-116257639 TTTTACAAATGAAAAAAGTGAGG - Intergenic
1196505073 X:116432755-116432777 GTTTACAAATTTACTAAAATAGG + Intergenic
1196547944 X:116986608-116986630 TTTTACAATTGTAATTGTTTTGG - Intergenic
1196753401 X:119137496-119137518 TTTTACAAATGTGAGAACTGAGG - Intronic
1196779567 X:119371373-119371395 TTTTAAAAATAGAATAAATAGGG - Intergenic
1196887256 X:120260033-120260055 GTTTAAAAATGTTATAAATTAGG - Exonic
1197434170 X:126405042-126405064 TTTTAATAATGTAATTAATTTGG + Intergenic
1197484482 X:127031202-127031224 TTATATAAATGTAACACATTTGG - Intergenic
1198065889 X:133096475-133096497 TTTTAAAAATGTAATATTTGTGG - Intronic
1198099054 X:133407973-133407995 TCTAACAAATGTTAGAAATTAGG - Intronic
1198130082 X:133685265-133685287 TTTTACACATCTCATGAATTGGG + Intronic
1198154260 X:133943038-133943060 TTTATCAACTCTAATAAATTGGG - Intronic
1198627606 X:138595878-138595900 TTCTAGAAATTTAATAATTTTGG - Intergenic
1198716035 X:139558530-139558552 TTTTAAAAATGTAACAAGATGGG + Intronic
1198768835 X:140106729-140106751 TTTTACAAATGAAAAAAACAAGG + Intergenic
1198974161 X:142316821-142316843 TTTGACAAATGTATACAATTGGG - Intergenic
1199279723 X:145986665-145986687 TTTTACATGTTTAATAAAATGGG - Intergenic
1199553672 X:149082430-149082452 TTTTAAAAATGTATTTAAGTTGG - Intergenic
1199820303 X:151439007-151439029 TTTTACAAATGTGAAAACTAAGG + Intergenic
1200550108 Y:4569113-4569135 TTTTAGAACTGTATGAAATTTGG + Intergenic
1200559348 Y:4680751-4680773 TTTTAGAACTGTATGAAATTTGG - Intergenic
1200573623 Y:4862956-4862978 TTTTAAAAATGTACTTATTTGGG + Intergenic
1201341366 Y:12937731-12937753 TTTTAAAAATTCATTAAATTTGG - Intergenic
1201610004 Y:15830565-15830587 TTGTACAAAAGTAAAAAAGTGGG - Intergenic
1201927960 Y:19310802-19310824 TATTTCAAATGAAAGAAATTGGG + Intergenic
1202385220 Y:24319721-24319743 TTTTACAAATGCAATTTACTTGG + Intergenic
1202485565 Y:25350407-25350429 TTTTACAAATGCAATTTACTTGG - Intergenic