ID: 968390877

View in Genome Browser
Species Human (GRCh38)
Location 4:192146-192168
Sequence TGGTGATCAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968390870_968390877 13 Left 968390870 4:192110-192132 CCAGAAGGTTGGAAGTCAGTGGT No data
Right 968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG No data
968390868_968390877 23 Left 968390868 4:192100-192122 CCTGCTGGATCCAGAAGGTTGGA No data
Right 968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG No data
968390866_968390877 24 Left 968390866 4:192099-192121 CCCTGCTGGATCCAGAAGGTTGG No data
Right 968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968390877 Original CRISPR TGGTGATCAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr