ID: 968390877 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:192146-192168 |
| Sequence | TGGTGATCAGCAGTGGTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 968390870_968390877 | 13 | Left | 968390870 | 4:192110-192132 | CCAGAAGGTTGGAAGTCAGTGGT | No data | ||
| Right | 968390877 | 4:192146-192168 | TGGTGATCAGCAGTGGTGGATGG | No data | ||||
| 968390868_968390877 | 23 | Left | 968390868 | 4:192100-192122 | CCTGCTGGATCCAGAAGGTTGGA | No data | ||
| Right | 968390877 | 4:192146-192168 | TGGTGATCAGCAGTGGTGGATGG | No data | ||||
| 968390866_968390877 | 24 | Left | 968390866 | 4:192099-192121 | CCCTGCTGGATCCAGAAGGTTGG | No data | ||
| Right | 968390877 | 4:192146-192168 | TGGTGATCAGCAGTGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 968390877 | Original CRISPR | TGGTGATCAGCAGTGGTGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||