ID: 968392681

View in Genome Browser
Species Human (GRCh38)
Location 4:205788-205810
Sequence TGCCAGGGAGTGGGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968392681_968392696 29 Left 968392681 4:205788-205810 CCCCAGGACCCCACTCCCTGGCA No data
Right 968392696 4:205840-205862 CACCAAAGCGCTCCCCATCCAGG No data
968392681_968392697 30 Left 968392681 4:205788-205810 CCCCAGGACCCCACTCCCTGGCA No data
Right 968392697 4:205841-205863 ACCAAAGCGCTCCCCATCCAGGG No data
968392681_968392692 -1 Left 968392681 4:205788-205810 CCCCAGGACCCCACTCCCTGGCA No data
Right 968392692 4:205810-205832 AAGGAGGGTGTCCTCAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968392681 Original CRISPR TGCCAGGGAGTGGGGTCCTG GGG (reversed) Intergenic
No off target data available for this crispr