ID: 968393955

View in Genome Browser
Species Human (GRCh38)
Location 4:215923-215945
Sequence CCAGAGAGAGCCTCTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968393955_968393958 15 Left 968393955 4:215923-215945 CCTCCATGAGAGGCTCTCTCTGG No data
Right 968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968393955 Original CRISPR CCAGAGAGAGCCTCTCATGG AGG (reversed) Intergenic
No off target data available for this crispr