ID: 968393957

View in Genome Browser
Species Human (GRCh38)
Location 4:215926-215948
Sequence AAACCAGAGAGAGCCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968393957_968393958 12 Left 968393957 4:215926-215948 CCATGAGAGGCTCTCTCTGGTTT No data
Right 968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968393957 Original CRISPR AAACCAGAGAGAGCCTCTCA TGG (reversed) Intergenic
No off target data available for this crispr