ID: 968393958

View in Genome Browser
Species Human (GRCh38)
Location 4:215961-215983
Sequence TGTAATCCCCAAGAATGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968393955_968393958 15 Left 968393955 4:215923-215945 CCTCCATGAGAGGCTCTCTCTGG No data
Right 968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG No data
968393957_968393958 12 Left 968393957 4:215926-215948 CCATGAGAGGCTCTCTCTGGTTT No data
Right 968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968393958 Original CRISPR TGTAATCCCCAAGAATGCAG AGG Intergenic
No off target data available for this crispr